Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cyclic AMP response element activator proteins and uses related thereto

A protein and activity technology, applied in the field of cyclic AMP response element activator protein and related uses

Inactive Publication Date: 2006-04-26
NOVARTIS AG
View PDF74 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

From these studies it is clear that the regulation of the activity of CREB / CRE / ATF1 family proteins in cells is highly complex to ensure specificity and sensitivity in generating appropriate cellular output from various extracellular stimuli.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1-5

[0253] A collection of human full-length cDNA clones

[0254] We have archived and sequenced approximately 170,000 clones at the 5' end from multiple high-quality full-length cDNA libraries prepared from mRNA from 33 human tissue types. Using proprietary bioinformatics methods, we have identified all cDNA clones with ORF initiation ATG codons that were either experimentally determined or conceptually predicted and thus likely represent full-length transcript. A total of 20,702 clones in the pCMVSport6 ​​vector (Invitrogen, Carlsbad, CA) from archived cloning series were rearranged into 384-well Genetix plates containing 60 μl LB medium (LB) using Q-bot (Genetix Limited, Hampshire, UK) middle. Based on bioinformatic analysis of the 5' sequences of these 20,702 clones, they were derived from approximately 11,000 genes for which there was strong evidence for structure and existence, although most of them were not functional, and 6,000 potential novel sequences Not yet present...

Embodiment 1

[0271] A genome-wide screen for cyclic AMP response element-activated genes

[0272]To identify cDNAs encoding proteins that lead to CRE activation, we screened a collection of annotated and indexed 20,702 human cDNA clones predicted to represent 11,000-16,000 clones within the miniaturized CRE-luciferase reporter gene system. full-length transcripts of a single gene. Experiments were performed in duplicate to generate 41,404 data points, each corresponding to luciferase activity from transient protein overexpression assays using approximately 3,000 pairs of cDNA clones of interest and plasmids containing the firefly luciferase gene HeLa cells were transiently transfected. Statistical analysis of the two sets of data has yielded a list of 85 clones resulting in at least an 8-fold increase in luciferase activity compared to the population median in 2 primary screening experiments in duplicate. In a subsequent second validation experiment, when individual colonies of these c...

Embodiment 2

[0275] DNA sequence and amino acid sequence of CREAP1 gene

[0276] Both strands of the 2.4 kb cDNA insert of the active CREAP1 clone were sequenced according to conventional methods. The results showed that the coding region of the gene was 1950 nucleotides and the amino acid sequence was predicted to be 650 amino acids. Bioinformatic analysis indicated that CREAP1 does not contain conserved protein functional domains (such as kinase ATP-binding domains or transcription factor DNA-binding domains) except for a proline-rich domain at amino acids 379-448 in the middle of the molecule. The DNA and amino acid sequences are shown below.

[0277] Confirmed full-length DNA sequence of CREAP1:

[0278] CCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCGTTTAGTG

[0279] AACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATC

[0280] CAGCCTCCGGACTCTAGCCTAGGCCGCGGGACGGATAACAATTTCACACAGGAAACAGCTATGACCAT

[0281] TAGGCCTATTTAGGTGACACTATAGAACAAGTTTGTACAAAAAAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses newly identified cyclic AMP response element activator proteins (CREAP proteins). It is mentioned herein that the protein is a suitable drug target for developing new therapeutic agents to prevent, treat or alleviate pathological conditions related to abnormal activation of CRE-dependent gene expression or abnormal activation of chemokines. The present invention relates to a method for preventing, treating or alleviating said pathological conditions and a pharmaceutical composition comprising a regulator having an inhibitory effect on CREAP protein activity and / or CREAP gene expression. The present invention also relates to methods of identifying compounds useful in the treatment of said pathological conditions, comprising identifying compounds capable of inhibiting CREAP protein activity and / or CREAP gene expression.

Description

Background of the invention [0001] Cyclic-AMP response element binding protein (CREB), activating transcription factor 1 (ATF1), and cAMP response element regulator (CREM) are a subgroup of closely related proteins belonging to the basic domain leucine zipper (bZIP) transcription factor superfamily . They are central regulators of transcriptional control produced by a variety of extracellular stimuli, such as hormones, growth factors, neuropeptides and neurotransmitters, calcium, hypoxia and oxidative stress. It has been well documented, primarily through CREB studies, that phosphorylation of conserved serine residues within the kinase-inducible domain (KID) of these proteins leads to the transcriptional activation of a variety of target genes involved in the regulation of cell growth and differentiation, metabolism, reproduction and development, regulation of neuronal activity, and immune regulation. All of these target genes have a conserved cis-acting loop-AMP response el...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12A61K38/00C07K14/47C07K16/18C12Q1/68G01N33/68
Inventor V·尤格恩科M·A·拉博宋川峥张文军朱健
Owner NOVARTIS AG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com