Two-temperature multiple PCR detectionmethod for prawn leukoplakia and taura syndrome virus
A technology of white spot syndrome and syndrome virus, which is applied in the field of detection of aquatic animal diseases, can solve the problems of no effective treatment methods, and achieve the effects of shortening detection time, preventing outbreaks, high specificity and sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0016] Embodiments of the invention
[0017] 1. Design two pairs of specific primers F1, R1, F2, and R2 for White Spot Syndrome Virus (WSSV) and Taura Syndrome Virus (TSV) respectively.
[0018] The size of the specific gene fragment for amplifying white spot syndrome virus is 451bp, in which the upstream primer F1 is 5'GCCCTGGAGAACACGTCC 3', and the downstream primer R1 is 5'TGGCGAACGGTGCAAGAGCC3'; the size of the specific gene fragment for amplifying Taura syndrome virus is 231bp , wherein the upstream primer F2 is 5'AAGTAGACAGCCGCGCTT 3', and the downstream primer R2 is 5'TCAATGAGAGCTTGGTCC3';
[0019] 2. White spot syndrome virus DNA extraction:
[0020] Take part of the hepatopancreas, stomach, intestines, and muscles of the diseased shrimp, cut them into pieces with scissors, and take about 100 mg of samples after mixing. Grind the sample in liquid nitrogen, add 1.3ml lysate (including Tris, EDTA, SDS), 7.5ul proteinase K, transfer to a 5ml centrifuge tube, digest in a...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com