Two-temperature multiple PCR detectionmethod for prawn leukoplakia and taura syndrome virus

A technology of white spot syndrome and syndrome virus, which is applied in the field of detection of aquatic animal diseases, can solve the problems of no effective treatment methods, and achieve the effects of shortening detection time, preventing outbreaks, high specificity and sensitivity

Inactive Publication Date: 2006-12-06
ZHEJIANG UNIV
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no effective treatment for shrimp virus diseases. The focus of disease prevention and control is on early detection and early prevention, so as to reduce the serious losses caused by the outbreak of mutual infection of diseases.
The detection of shrimp diseases mainly includes traditional histopathology methods, serum immunology methods and modern molecular biology methods, among which polymerase chain reaction (PCR) detection technology is widely used in molecular biology methods, two-temperature PCR and Multiplex PCR is a special form of PCR. They have been used in the detection of shrimp disease pathogens. For example, Pang Yaoshan et al. used two-temperature PCR for the detection of white spot syndrome virus. Xia Chun et al. applied multiplex PCR to shrimp. For the detection of subcutaneous and hematopoietic organ necrosis baculovirus, this invention, the two-temperature multiplex PCR, combines the advantages of two-temperature PCR and multiplex PCR, and can effectively and quickly detect two viruses of prawn white spot syndrome and taura syndrome at the same time , making the detection faster and easier, saving time and effort, which has not been reported in the detection of pathogens in prawns

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0016] Embodiments of the invention

[0017] 1. Design two pairs of specific primers F1, R1, F2, and R2 for White Spot Syndrome Virus (WSSV) and Taura Syndrome Virus (TSV) respectively.

[0018] The size of the specific gene fragment for amplifying white spot syndrome virus is 451bp, in which the upstream primer F1 is 5'GCCCTGGAGAACACGTCC 3', and the downstream primer R1 is 5'TGGCGAACGGTGCAAGAGCC3'; the size of the specific gene fragment for amplifying Taura syndrome virus is 231bp , wherein the upstream primer F2 is 5'AAGTAGACAGCCGCGCTT 3', and the downstream primer R2 is 5'TCAATGAGAGCTTGGTCC3';

[0019] 2. White spot syndrome virus DNA extraction:

[0020] Take part of the hepatopancreas, stomach, intestines, and muscles of the diseased shrimp, cut them into pieces with scissors, and take about 100 mg of samples after mixing. Grind the sample in liquid nitrogen, add 1.3ml lysate (including Tris, EDTA, SDS), 7.5ul proteinase K, transfer to a 5ml centrifuge tube, digest in a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to view more

Abstract

This invention provides a method for simultaneous detecting white spot syndrome virus (WSSV) and taura syndrome virus (TSV) by two-temperature multiplex PCR. The method comprises: (1) designing two pairs of specific primers according to conserved sequences of WSSV and TSV; (2) simultaneously detecting WSSV and TSV by two-temperature multiplex PCR. The method has such advantages as simple operation, rapid detection, high specificity, high sensitivity and low cost. the method can be used for simultaneous detection of WSSV and TSV, Penaeus chinensis health investigation, epidemic control and differential diagnosis.

Description

technical field [0001] The invention belongs to the detection technology of aquatic animal diseases, and mainly aims at the simultaneous detection of shrimp white spot syndrome virus (White spot syndrome virus, WSSV) and taura syndrome virus (taura syndrome virus, TSV). Background technique [0002] White spot syndrome virus is the pathogen of white spot syndrome in prawns. It is named after the white spots on the inside of the shell of dead shrimp. China first discovered white spot syndrome in Taiwan in 1992. The disease spread rapidly in coastal areas and became a common disease in shrimp farming in China. the main threat. White spot syndrome virus disease has also been found in Malaysia, Indonesia, Thailand, Japan, the Philippines, South Korea and parts of the United States. The virus has a large molecular weight and a specific structure. It is the largest virus among known animal viruses. It is a double-stranded DNA virus. The complete virus is in the shape of a coil, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 吴刘记吴信忠
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products