Oligomers

a technology of oligomers and oligomers, applied in the field of oligomers, can solve the problems of undesirable immune responses and long-term sustainability difficulties, and achieve the effects of reducing specificity of binding to the target site, excellent safety profiles, and long-lasting effects

Inactive Publication Date: 2013-04-04
ROYAL HOLLOWAY & BEDFORD NEW COLLEGE
View PDF3 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The patent describes a method for increasing or maintaining muscle mass and slowing the degeneration of muscle mass using oligomers that can bind to a specific site in the myostatin pre-mRNA and cause exon skipping. The oligomers can be any type of oligonucleotide that can bind to the target site, such as an oligodeoxyribonucleotide, an oligoribonucleotide, a phosphorodiamidate morpholino oligonucleotide (PMO), or a phosphorothioate-linked 2'O-methyl oligonucleotide (2'OMePS). The base sequence of the oligomer can vary from the selected sequence at up to two base positions. The oligomers can be at least 20 bases in length, preferably at least 25 bases in length, and should not be longer than 40 bases in length. The oligomers can be used to treat muscle wasting conditions such as degenerative muscular disorders, including Duchenne muscular dystrophy. They can also be used to increase muscle mass or slow down the degeneration of muscle mass in other conditions such as cachexia, sarcopenia, muscle atrophy, and diabetes.

Problems solved by technology

However, there are some constraints related to the use of antimyostatin antibodies that include difficulty in long-term sustainability, undesirable immune responses, and inhibitory effects not precisely specific to myostatin in regard to muscle growth.8,9 Significant increase in skeletal muscle mass was also observed using adeno-associated virus vectors to deliver a recombinant myostatin propeptide gene fragment, or by a retrovirus-based RNA interference system (RNAi).4,6,10 Both approaches have safety concerns of possible genotoxicity, due to uncontrolled vector genome insertion into host chromosomes.11 The RNAi system faces an additional hurdle in terms of effective delivery of the RNAi molecules into the disease models for clinical studies.12 RNA-based modulation therapy has the potential to overcome difficulties encountered by conventional gene therapy methods.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligomers
  • Oligomers
  • Oligomers

Examples

Experimental program
Comparison scheme
Effect test

example 1

Materials and Methods

Bioinformatics Analysis of the Myostatin Gene to Design AOs Reagents.

[0041]Three different bioinformatics algorithms namely ESE Finder, PESX, and Rescue ESE were used to design antisense reagents. Results from the three algorithms were merged to define ESE sites and used to identify the regions of the myostatin exon 2, which are expected to be optimal targets for exon skipping antisense reagents. A set of 12 antisense reagents of 2'O-methyl RNA (2'OMePS) chemistry were designed to target four different ESE-rich regions of exon 2 of myostatin (FIG. 1a).

AO Reagents.

[0042]The 12 2'OMePS oligomers tested were obtained from Eurogentec (SA, Seraing, Belgium). The sequences of the 2'OMePS are as follows:

GDF8 / A1:TCCACAGTTGGGCTTTTACTGDF8 / A2:TCTGAGATATATCCACAGTTGDF8 / A3:TCTTGACGGGTCTGAGATATGDF8 / B1:TGATGAGTCTCAGGATTTGCGDF8 / B2:TTCATGGGTTTGATGAGTCTGDF8 / B3:TTGTACCGTCTTTCATGGGTGDF8 / C1:CAGAGATCGGATTCCAGTATGDF8 / C2:TGTCAAGTTTCAGAGATCGGGDF8 / C3:CCTGGGCTCATGTCAAGTTTGDF8 / D1:CTGGGAAGGT...

example 2

[0062]The 30-mer PMO AOs tested above (Mstn-A to Mstn-D) were designed to target the myostatin gene in mice. Therefore, these Mstn-A to Mstn-D sequences correspond (are complementary to) to the Genbank mouse myostatin cDNA / mRNA gene sequence. The corresponding sequences complementary to the Genbank human myostatin sequences are as follows with differences between the Genbank mouse and human underlined:

Hum Mstn A:TCTCGACGGGTCTCAAATATATCCATAGTTHum Mstn B:TGTACCGTCTTTCATAGGTTTGATGAGTCTHum Mstn C:CCTGGGTTCATGTCAAGTTTCAGAGATCGGHum Mstn D:CAGCCCATCTTCTCCTGGTCCTGGGAAGGT

[0063]The skipping efficiency of these AOs can be tested by transfection (leashed or unleashed: concentration between 50 and 500 nM) into cultured human myoblast cells (eg using a transfection reagent such as Lipofectamine2000™), and evaluation of skipped and unskipped mRNAs by electrophoretic densitometric analysis of RTPCR reaction products.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Massaaaaaaaaaa
Login to View More

Abstract

Certain disclosed oligomers induce exon skipping during processing of myostatin pre-mRNA. The oligomers may be in a vector or encoded by the vector. The vector is used for inducing exon skipping during processing of myostatin pre-mRNA. A therapeutically effective amount of the oligomer may be administered to a subject patient such that exon skipping during processing of myostatin pre-mRNA is induced. The administration to a subject may be used in order to increase or maintain muscle mass, or slowing degeneration of muscle mass in the subject. The administration to a subject may ameliorate muscle wasting conditions, such as muscular dystrophy. Examples of such muscular dystrophies which may be so treated include Becker's muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular dystrophy, myotonic muscular dystrophy, and oculopharyngeal muscular dystrophy

Description

FIELD OF THE INVENTION[0001]The present invention relates to oligomers which are capable of causing exon skipping and, in particular, relates to oligomers which are capable of causing exon skipping in the myostatin gene.BACKGROUND TO THE INVENTION[0002]A range of strategies have been proposed to enhance muscle bulk and strength as a treatment for a number of age-related muscle disorders and various neuromuscular disorders, including muscular dystrophies. Myostatin, a transforming growth factor-β family member, also called growth and differentiation factor-8, is a negative regulator of muscle growth and the myostatin signalling axis has been a major focus in such strategies. Myostatin null or hypomorphic animals are significantly larger than wild-type animals and show a large increase in skeletal muscle mass.1 The first natural myostatin mutation in humans has also been identified in a young boy.2 Myostatin blockade, therefore, offers a strategy for counteracting muscle-wasting condi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/5377C12N15/85A61K31/713A61P21/00C07H21/04C07D473/34
CPCC07H21/04A61K47/48023C12N2320/30C12N2310/11C12N15/1136A61K47/54A61P21/00C12N15/1138C12N2310/314C12N2310/321C12N2310/3233C12N2320/31C12N2320/33
InventorDICKSON, JOHN GEORGEKANG, JAGJEET KAUR
OwnerROYAL HOLLOWAY & BEDFORD NEW COLLEGE