Human, rat, mouse HSP70 double antibody sandwich method detection reagent kit
A detection kit and double-antibody sandwich technology, which is applied to measuring devices, material analysis by observing the impact on chemical indicators, instruments, etc., can solve the problem of narrow detection range, not reaching the level of production detection, low detection sensitivity, etc. problem, to achieve the effect of strong accuracy, low cost and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035]A human, rat, and mouse HSP70 double-antibody sandwich method detection kit, comprising a box body, a microtiter plate of a solidified HSP70 monoclonal antibody arranged in the box body, and materials arranged in the box body, and the materials in the box body include HIS -HSP70 protein standard, biotin-labeled HSP70 polyclonal antibody, sample diluent, washing buffer, antibody diluent, horseradish enzyme-labeled avidin, horseradish enzyme-labeled avidin diluent, substrate chromogenic solution Solution A, substrate display solution B and stop solution.
Embodiment 2
[0037] HIS-HSP70 protein standard is prepared by the following method:
[0038] 1.) First design PCR amplification primers:
[0039] Upstream: 5'CGGAATTCATGGCCAAGAAAACAGCG 3'
[0040] Downstream: 5'CCCAAGCTTCTAATCCACCTCCTCGAT 3'
[0041] PCR amplification, amplification conditions are:
[0042] 95℃4min; 95℃30s 56℃60s 72℃60s(30cycle); 72℃10min
[0043] Ligated into plasmid PET-32a after double digestion with EcoR I and HinDIII
[0044] 2.) The recombinant plasmid was transformed into Escherichia coli BL21 and shaken at 37°C. When the OD value was 0.5, IPTG 1.0ul / ml was added, induced for 4 hours, ultrasonically disrupted, and the supernatant was collected by centrifugation.
[0045] 3.) Purify the collected supernatant according to the instructions of the HISTrap purification kit from Pharmacia. After exploring the best purification conditions are: 1ml purification column, 6ml of column equilibration solution - sample loading (1ml supernatant, flow rate 0.5ml / ml) - column ...
Embodiment 3
[0055] Biotin-labeled HSP70 protein polyclonal antibody is prepared by the following method:
[0056] (1) Preparation of HSP70 protein polyclonal antibody
[0057] Select healthy female rabbits over 2 kg as immune animals, use 2 mg / ml of the HIS-HSP70 protein prepared in Example 2 as the immune antigen, and store at -4 ° C; The complete adjuvant, fully mixed, multi-point subcutaneous injection on the back of the rabbit, 0.2ml per point, 0.2ml in the groin of the lower limbs;
[0058] One month later, add 0.5ml immune antigen plus 0.5ml Freund's complete adjuvant, mix thoroughly, and inject 0.2ml subcutaneously at multiple points on the back of the rabbit, and 0.2ml in the groin of the lower limbs;
[0059] One month later, 0.5ml of immune antigen was injected into the ear vein;
[0060] After 7-10 days, blood was collected from the carotid artery, the serum was separated, and a 1% thimerosal aqueous solution (0.8% or 1.2% thimerosal aqueous solution could also be selected as...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
