Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Human, rat, mouse HSP70 double antibody sandwich method detection reagent kit

A detection kit and double-antibody sandwich technology, which is applied to measuring devices, material analysis by observing the impact on chemical indicators, instruments, etc., can solve the problem of narrow detection range, not reaching the level of production detection, low detection sensitivity, etc. problem, to achieve the effect of strong accuracy, low cost and high detection sensitivity

Inactive Publication Date: 2008-01-16
INST OF HYGIENE & ENVIRONMENTAL MEDICINE PLA ACAD OF MILITARY MEDICAL
View PDF0 Cites 21 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Most of the sales companies in this area in my country are agents or imported subpackages, and there are occasional reports of self-developed products, but the detection sensitivity is low, the detection range is narrow, and it is far from the level of production detection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human, rat, mouse HSP70 double antibody sandwich method detection reagent kit
  • Human, rat, mouse HSP70 double antibody sandwich method detection reagent kit
  • Human, rat, mouse HSP70 double antibody sandwich method detection reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035]A human, rat, and mouse HSP70 double-antibody sandwich method detection kit, comprising a box body, a microtiter plate of a solidified HSP70 monoclonal antibody arranged in the box body, and materials arranged in the box body, and the materials in the box body include HIS -HSP70 protein standard, biotin-labeled HSP70 polyclonal antibody, sample diluent, washing buffer, antibody diluent, horseradish enzyme-labeled avidin, horseradish enzyme-labeled avidin diluent, substrate chromogenic solution Solution A, substrate display solution B and stop solution.

Embodiment 2

[0037] HIS-HSP70 protein standard is prepared by the following method:

[0038] 1.) First design PCR amplification primers:

[0039] Upstream: 5'CGGAATTCATGGCCAAGAAAACAGCG 3'

[0040] Downstream: 5'CCCAAGCTTCTAATCCACCTCCTCGAT 3'

[0041] PCR amplification, amplification conditions are:

[0042] 95℃4min; 95℃30s 56℃60s 72℃60s(30cycle); 72℃10min

[0043] Ligated into plasmid PET-32a after double digestion with EcoR I and HinDIII

[0044] 2.) The recombinant plasmid was transformed into Escherichia coli BL21 and shaken at 37°C. When the OD value was 0.5, IPTG 1.0ul / ml was added, induced for 4 hours, ultrasonically disrupted, and the supernatant was collected by centrifugation.

[0045] 3.) Purify the collected supernatant according to the instructions of the HISTrap purification kit from Pharmacia. After exploring the best purification conditions are: 1ml purification column, 6ml of column equilibration solution - sample loading (1ml supernatant, flow rate 0.5ml / ml) - column ...

Embodiment 3

[0055] Biotin-labeled HSP70 protein polyclonal antibody is prepared by the following method:

[0056] (1) Preparation of HSP70 protein polyclonal antibody

[0057] Select healthy female rabbits over 2 kg as immune animals, use 2 mg / ml of the HIS-HSP70 protein prepared in Example 2 as the immune antigen, and store at -4 ° C; The complete adjuvant, fully mixed, multi-point subcutaneous injection on the back of the rabbit, 0.2ml per point, 0.2ml in the groin of the lower limbs;

[0058] One month later, add 0.5ml immune antigen plus 0.5ml Freund's complete adjuvant, mix thoroughly, and inject 0.2ml subcutaneously at multiple points on the back of the rabbit, and 0.2ml in the groin of the lower limbs;

[0059] One month later, 0.5ml of immune antigen was injected into the ear vein;

[0060] After 7-10 days, blood was collected from the carotid artery, the serum was separated, and a 1% thimerosal aqueous solution (0.8% or 1.2% thimerosal aqueous solution could also be selected as...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a test kit of HSP70 double antibody sandwich method used in the sample drawn from human, big mice and small mice, and comprises a kit body, an enzyme-labeled plate of solidified HSP70 monoclonal antibody provided in the kit body and substances provided in the kit body; the substances provided in the kit body comprises a HIS-HSP70 protein standard reagent, a HSP70 polyclonal antibody labeled by biotin, a sample dilution solution, a cleaning buffer solution, an antibody solution, a horseradish enzyme-labeled avidin, a horseradish enzyme-labeled avidin dilution solution, a substrate visualization solution A solution, a substrate visualization solution B solution and a stop solution. The invention has the advantages of high detection sensitivity, big accuracy and low cost; the invention can detect the HSP70 protein in a cell lysis solution, a tissue extracting solution, plasma and serum drawn from human, big mice and small mice at the same time.

Description

technical field [0001] The invention relates to a biotechnology product, in particular to a detection kit for rapid detection of HSP70 protein by a double-antibody sandwich method and a preparation method thereof. Background technique [0002] The heat shock protein family (HSPs) is a class of highly conserved proteins, and HSP70 is an important member of the heat shock protein family, which is divided into inducible and constitutive. When the body is stimulated by various adverse factors in the external environment, the expression of inducible HSP70 protein increases. HSP70 proteins are essential for the repair of cell damage, survival and maintenance of normal cell function. It acts as a molecular chaperone in environmental stimuli, pathogen infection, and cell stress damage caused by diseases, preventing protein aggregation and promoting the refolding of damaged proteins. In most mammals, HSP70 is expressed only under stress conditions and can be detected after signific...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/577G01N33/531G01N33/543G01N21/78
Inventor 钱令嘉冷雪战锐
Owner INST OF HYGIENE & ENVIRONMENTAL MEDICINE PLA ACAD OF MILITARY MEDICAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com