Recombinant yeast for unsymmetrical conversion and preparation of (S)-4-chloro-3-hydroxybutanoate and construction method and use thereof

A technology of ethyl hydroxybutyrate and ethyl chloroacetoacetate, which is applied in the field of biocatalytic asymmetric transformation, can solve the problems of difficulty in screening microbial strains and low optical activity of products, achieve high forwarding rate, high optical activity, and reduce production cost effect

Inactive Publication Date: 2009-03-25
NANJING UNIV OF TECH
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In summary, the existing technology for catalyzing COBE to (S)-CHBE is only reported by Sun Zhihao, which does not require the addition of coenzymes for the reaction, and because wild strains often contain a variety of reductases that can catalyze COBE into different configurations of CHBE Therefore, the optical activity of the products obtained by using wild strains for catalysis is often not high, and it is very difficult to screen excellent microbial strains with high stereoselectivity. Therefore, recent research has focused on the use of recombinant bacteria for asymmetric synthesis with high stereoselectivity (S)-CHBE

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant yeast for unsymmetrical conversion and preparation of (S)-4-chloro-3-hydroxybutanoate and construction method and use thereof
  • Recombinant yeast for unsymmetrical conversion and preparation of (S)-4-chloro-3-hydroxybutanoate and construction method and use thereof
  • Recombinant yeast for unsymmetrical conversion and preparation of (S)-4-chloro-3-hydroxybutanoate and construction method and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1: Construction of recombinant yeast

[0039] 1. Acquisition of carbonyl reductase PsCR gene and glucose dehydrogenase GDH gene.

[0040] Pichia stipitis CBS 6054 medium YPD (g L -1 ): Yeast extract 10g, peptone 20g, glucose 20g.

[0041] Pichia pastoris was inoculated in 5 mL of YPD liquid medium and cultured at 30°C until the logarithmic growth phase, and the genome was extracted using a genomic DNA extraction kit (kit from Beijing Tianwei Bioengineering Co., Ltd.).

[0042] The primers used to construct MCS1 in the expression vector are added with restriction sites, and the primer sequences are as follows:

[0043] The upstream primer (-sense contains BamH I) is: 5'CGC GGATCC ATGGCTAAGAACTTCTCCAAC

[0044] The downstream primer (-anti containing Xho I) is: CCG CTCGAG TTAGGGAAGCGTGTAGCCAC

[0045] All primers were synthesized by Shanghai Shenergy Gaming Company.

[0046] Gene PCR conditions (50μL system):

[0047] Denaturation at 94°C for 7 min, f...

Embodiment 2

[0082] Embodiment 2: Fermentation of recombinant yeast (CCTCC NO: M 208129)

[0083] Pick the monoclonal PESC-GDH-PsCR that has been identified as positive, and inoculate it in 5 mL of leucine-deficient SD medium, overnight at 30°C. Inoculate in leucine-deficient SG medium according to the inoculum amount of 2%, and induce for 16 hours at 30°C. 8000rpm, centrifuge at 4°C for 10min, discard the supernatant.

[0084] The formula of SG medium is as follows:

[0085] Galactose 20g

[0086] Yeast nitrogen source (not containing leucine) 6.7g, its formula is shown in Table 1;

[0087] Water to 1000ml. Example 3:

Embodiment 3

[0088] The precipitate of Example 2 was washed twice with potassium phosphate buffer (100mmol·L-1, pH 6.0), weighed 0.5g (wet weight) of recombinant yeast sludge, and suspended in 5mL of pH 6.0 potassium phosphate buffer. Cells were sonicated (power 300W, sonication 5s, intermittent 5s, 5min in total), adding glucose 100mmol / L, COBE 1g / L, 24°C, 190rpm, 18h. The yield of the product (S)-CHBE is 0.99 g / L, the yield of the product is: 99%, and the optical purity e.e% is 100%.

[0089] The detection method of (S)-CHBE is as follows, and the detection method of product is identical in the following examples:

[0090] For the aqueous phase reaction: after the reaction, add an equal volume of ethyl acetate, vibrate vigorously for 10 minutes, then place it for two hours, and centrifuge at 8000rpm for 10 minutes to separate the organic layer and the aqueous layer. Carefully draw the upper layer of ethyl acetate through the organic membrane, add the internal standard, and save the test...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recomposed yeast for asymmetrically transforming and preparing (S)-4-chlorine-3-hydroxy-ethylbutyrate, which is Saccharomyces cerevisiae for reducing enzyme gene and glucose dehydrogenase gene by the introduction of carbonyl. The invention further discloses a composition method of the recomposed yeast. The method for preparing (S)-4-chlorine-3-hydroxy-ethylbutyrate by using the recomposed yeast is that: 4-chloracetyl-ethyl-acetate is used as a substrate, glucose is used as an auxiliary substrate, and the recomposed yeast is used for the transformation reaction so as to prepare (S)-4-chlorine-3-hydroxy-ethylbutyrate. The recomposed yeast, without adding any auxiliary enzyme, can effectively catalyze 4-chloracetyl-ethyl-acetate into (S)-4-chlorine-3-hydroxy-ethylbutyrate, with optical purity e.e value larger than 98 percent and the transformation ratio to the substrate larger than 95 percent, thus reducing the production cost. Compared with other strains without the need to add expensive auxiliary enzyme, the recomposed yeast has high transformation ratio to the substrate and high optical activity.

Description

technical field [0001] The invention belongs to the technical field of biocatalytic asymmetric transformation, and in particular relates to a recombinant yeast for preparing (S)-4-chloro-3-hydroxybutyric acid ethyl ester through asymmetric transformation and its construction method and application. Background technique [0002] (S)-4-chloro-3-hydroxybutanoate (Ethyl 4-chloro-3-hydroxybutanoate, (S)-CHBE) is an important organic intermediate, which can be used in the synthesis of many active drugs, such as statins Drugs - hydroxymethylglutaryl CoA (HMG-CoA) reductase inhibitors and 4-hydroxypyrrolidone (4-hydroxypyrrolidone), etc. [1]. Using 4-chloroacetoacetate ethyl (COBE) as the latent chiral substrate of the reduction reaction is easy to synthesize and low in price, and it is a very economical and effective preparation method to obtain (S)-CHBE by asymmetric reduction reaction using it as the substrate . [0003] So far, many studies have been reported on the preparatio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/53C12N15/81C12P7/62C12R1/865
Inventor应汉杰许琳叶齐严明熊健柏建新陈勇李振江
OwnerNANJING UNIV OF TECH