Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for separating, purifying, culturing and proliferating totipotent stem cell from tissue of early aborted fetus of human being

A totipotent stem cell, separation and purification technology, applied in the field of separation and purification of stem cells, can solve problems such as incomplete embryonic stem cells

Inactive Publication Date: 2009-09-23
叶尚勉
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, not fully characterized by embryonic stem cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for separating, purifying, culturing and proliferating totipotent stem cell from tissue of early aborted fetus of human being
  • Method for separating, purifying, culturing and proliferating totipotent stem cell from tissue of early aborted fetus of human being
  • Method for separating, purifying, culturing and proliferating totipotent stem cell from tissue of early aborted fetus of human being

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1: Isolation, purification, culture, proliferation and identification of totipotent stem cells from human early aborted fetal tissue

[0058] 1.1 Materials and methods

[0059] 1.1-1. Reagents

[0060] α-MEM medium (α-MEM), fetal calf serum (FCS) and trypsin-EDTA (trypsin-EDTA) solution were purchased from Invirogen (USA). Penic / streptomycin and amphotericin B, type I collagenase and goat anti-mouse antibody-HRP complex were purchased from Sigma (USA). Monoclonal antibodies against OCT-4, SSEA-1, SSEA-3, SSEA-4, TRA-1-60 and TRA-1-81 were purchased from R&D System (USA). Monoclonal antibodies against AFP, Nestin and SMA were purchased from Sigma (USA) and Dako (Denmark). The reverse transcription (RT) kit was purchased from Promega (USA); the DNA Taq enzyme kit was purchased from Qiogen (Germany). Primers for RT-PCR were synthesized by Invirogen.

[0061] 1.1-2. Collection of samples and isolation of fetal tissue cells

[0062] The fetal-placental tissues ...

Embodiment 2

[0096] Example 2: In vitro differentiation of stem cells---islet β-cells

[0097] 2.1 Materials and methods

[0098] 2.1-1. Reagents: Purchase phosphate buffered solution (PBS) from Invitrogen; α-minimallessential medium (α-MEM); Dulbecco modified Eagle's medium (DMEM); F12 medium, fetal calf serum (FCS); knockout serum; / Streptomycin; Amphotericin B; L-glutamin; 0.25% Trypsin-EDTA; B27-supplement, bFGF. Insulin, transferrin, selenium chloride, fibronectin and putrescine were purchased from Sigma. Anti-Insulin and Nestin anti-specific antibodies were purchased from Dako (Denmark). Insulin ELISA Kit was purchased from Abbott (USA).

[0099] 2-1-2. Methods: The method of directed differentiation of pancreatic islet β-cells mainly refers to the literature published by Lumelsky et al. (Lumeksky et al. 2006). This method divides the in vitro differentiation process into five stages. In Phase I, undifferentiated stem cells are expanded in culture. In stage II, the expanded ste...

Embodiment 3

[0118] Example 3: In vitro differentiation of stem cells---cardiomyocytes

[0119] 3.1 Materials and methods

[0120]3.1-1 Reagents: Purchase phosphate buffer solution (PBS) from Invitrogin; α-minimallessential medium (α-MEM); Dulbecco modified Eagle's medium (DMEM); fetal calf serum (FCS); knockout serum; penicillin / streptomycin; Sexomycin B; L-glutamin; 0.25% Trypsin-EDTA; β-mercaptoethanol; non-essential amino acids; , cTnl) antibody was purchased from Chemicon (USA); primers for RT-PCR: α-myosin light chain ventricular (α-MHC) (ggggacagtggtaaaagcaa (sense), tccctgcgttccactatctt (antisense); 512bp), Nkx2. 5 (ggtggagctggagaagacaga(sense), cgacgccgaagttcacgaagt(antisense); 536bp) (Passier et al. 2005). Atrial natriuretic factor (ANF) (gaaccagagggggagacagag (sense), ccctcagcttgctttttaggag (antisense), 406bp) and myosin light chain 2v (myosin light chain 2v, MLC2v) (firstround: gcgccaactccaacgtgttct (sense); gtgatgatgtgcca (cca ); nested PCR: aggaggccttcactatcatgg (sense); g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for separating and purifying totipotent stem cells from the tissues of early aborted fetuses of human beings, including the steps: a. a sample of the placenta tissue of the aborted fetus after the first pregnancy period is collected; b. the umbilical cord tissue or the intestine tissue of the fetus is obtained from the sample gained in the step a; c. cells are obtained from the umbilical cord tissue or the intestine tissue of the fetus gained in the step b; and d. markers of the embryonic stem cell, such as OCT-4, Nanog, SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and the like which are obtained from the cells of the umbilical cord tissue or the intestine tissue of the fetus, are separated, purified and expressed, and can form the stem cell of an embryoid body. The cells obtained by the method of the invention are always in the state of undifferentiation. The invention also discloses the application of the stem cells in forming different human cells, such as cardiac muscles, nerves and islet beta cells or osseus cells. The method avoids the dispute over ethnics which needs to be faced with during the operation of obtaining the totipotent stem cells from the embryo, and more stem cells can be obtained than from blastocyst.

Description

technical field [0001] The invention relates to a method for isolating and purifying stem cells. Specifically, the method can be used for isolating, purifying, cultivating and proliferating totipotent stem cells from early abortion fetal tissue, including umbilical cord or intestinal tissue of the fetus. Background technique [0002] For diseases of human tissue and organ defects and dysfunction caused by various factors, such as Parkinson's disease, diabetes, traumatic spinal cord injury, cell degeneration, burns, cardiomyopathy and bone injury, modern medicine has no effective treatment. treatment method. However, with the discovery of stem cells and the continuous deepening and development of stem cell research in recent years, new hope has been brought to cure these diseases. Therefore, research on human stem cells has become the most active research field in life science after the Human Genome Project; it will also be an epoch-making innovation in the treatment of huma...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/08
Inventor 叶尚勉
Owner 叶尚勉
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com