Trichoderma biocontrol recombinant engineering bacteria for efficiently expressing chitinase coding gene and Beta-1,3-glucanase coding gene as well as application thereof

A technology of recombinant engineering bacteria and chitinase, applied in genetic engineering, application, plant genetic improvement and other directions, can solve the problems of poor biocontrol effect, undiscovered, unstable functional gene content, etc.

Inactive Publication Date: 2010-06-09
BIOTECH CENT OF SHANDONG ACAD OF SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] However, the above-mentioned reports about β-1,3 glucanase and chitinase are only limited to the stage of mechanism exploration and experimental testing of Trichoderma as an antagonistic enzyme against some pathogenic fungi, and only confirmed that the original Trichoderma has The function of preventing and controlling fungi, while the original Trichoderma fungus has poor biocontrol effect due to the unstable content of functional genes
So far, no literature reports have been found on how to stabilize and improve the chitinase and β-glucanase genes in Trichoderma, and how to obtain higher biocontrol effects of Trichoderma biocontrol recombinant engineering bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma biocontrol recombinant engineering bacteria for efficiently expressing chitinase coding gene and Beta-1,3-glucanase coding gene as well as application thereof
  • Trichoderma biocontrol recombinant engineering bacteria for efficiently expressing chitinase coding gene and Beta-1,3-glucanase coding gene as well as application thereof
  • Trichoderma biocontrol recombinant engineering bacteria for efficiently expressing chitinase coding gene and Beta-1,3-glucanase coding gene as well as application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1: Cloning of Trichoderma chitinase Chi42 and β-1,3-glucanase encoding genes glultr-2

[0038] Inoculate Trichoderma viride LTR-2 conidia in PDB medium (the formula is: potato 200g; glucose 15g; deionized water to make the volume to 1000mL, peel the potato, cut into small pieces, add 1000mL water to the pot Boil for half an hour, filter with double gauze, take the filtrate, add sugar, and add water to make up to 1000mL), culture for 48-72h, extract genomic DNA, and check DNA purity and quantification by electrophoresis. Using genomic DNA as template, using the upstream primer Chi42XhoI-F: 5’GC CTCGAG ATGTTGGGCTTCCTCGG 3'(the underlined part is the XhoI restriction site) downstream primer Chi42XhoI-R: 5'GC CTCGAG CTTGTCGAACAAGCTTCTAGTTGAGACC 3'(the underlined part is the XhoI restriction site) for PCR amplification. Add 5μL of 10×Taq DNA polymerase buffer to the 50μL reaction system, the upstream and downstream primers to 20μM, dNTP 100μM, MgCl2 1mM, template DNA ...

Embodiment 2

[0040] Example 2: Construction of p1302-chi42

[0041] The CaMV35S promoter and terminator of the hygromycin gene hph of pCAMBIA1300 were used as the 42kDa chitinase gene promoter and terminator, and then inserted into the expression vector pCAMBIA1302. Constructed to obtain p1302-chi42. The specific method is as follows:

[0042] The first is the connection between the plasmid pCAMBIA1300 and the chitinase gene. The PCR amplification product of the 42kDa chitinase gene contains XhoI restriction sites at both ends. The PCR amplification product is directly digested with XhoI and then digested with XhoI. The dephosphorylated pCAMBIA1300 vector was ligated with T4 ligase and transformed into E. coli. Due to the problem of forward and reverse for single enzyme digestion, we use PCR and SacI digestion methods. Forward connection, the sequence between the two restriction sites is about 2.4kb, and the reverse connection is about 1.1kb. The positive clones screened by SacI digestion PC...

Embodiment 3

[0043] Example 3: Construction of p1302-chi42-glultr-2

[0044] The recombinant plasmid pMD18-T-glultr-2 was used as a template for PCR amplification. The 50μL PCR reaction system is: 10×pyrobestbufferII 5μL, upstream and downstream primers 20μM, dNTP 100μM, MgCl2 1mM, template 1μL, pyrobest DNA Polymerase 0.5μL, ddH 2 Make up to 50 μL of O. The primer sequence is as follows

[0045] gluEZF5′ CTCTTGACCATGGTAGATCTG ACTAGTATGTTGAAGCTCACGGCGCTCG

[0046] (The underlined part is the same nucleic acid sequence as one end of the pCAMBIA1302 vector linearized by SpeI)

[0047] gluEZR5′ GTGAAAAGTTCTTCTCCTTT ACTAGTAGTAGTATAACGGGCAACGTCACCACCTCC (the underlined part is the same nucleic acid sequence as the other end of the pCAMBIA1302 vector linearized by SpeI). The reaction conditions are: 94°C pre-denaturation for 5 minutes; 94°C denaturation for 1 minute, 58°C annealing for 1.5 minutes, 72°C extension for 2 minutes, 30 cycles; Extension at 72°C for 10 min. Recover PCR products and use ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses trichoderma biocontrol recombinant engineering bacteria for efficiently expressing chitinase and Beta-1,3-glucanase genes derived from trichoderma as well as application thereof. The recombinant bacterial strain is the recombinant engineering bacteria which are acquired by converting trichoderma viride LTR-2 with plant disease biocontrol function from a T-DNA derived carrier which is mediated by agrobacterium and contains the chitinase code gene chi42 derived from the trichoderma and the Beta-1,3-glucanase coding gene glultr-2. The recombinant bacteria can stably express the chitinase code gene chi42 and the Beta-1,3-glucanase coding gene glultr-2 in a PDA culture medium; and a pot plant experiment indicates that the recombinant engineering bacteria have more effective prevention and control effects to vegetable botrytis and wheat sharp eyespot compared with glutamicum LTR-2.

Description

Technical field: [0001] The invention belongs to the field of bioengineering. Specifically, it relates to a method for constructing a biocontrol engineering bacteria of Trichoderma by using a chitinase encoding gene and a β-1,3-glucanase encoding gene and its application. Background technique: [0002] Chitin is a polymer linked by N-acetyl-D-glucosamine via (1-4)-β bonds, and is one of the abundant polymers in the biosphere. Chitinase (lyase) exists in every corner of the biosphere, such as protists, bacteria, fungi, plants, invertebrates and vertebrates, even humans. Many biochemical processes include enzymatic degradation of chitin, such as self-decomposition, morphogenesis, and nutrient absorption, among organic matter, including plant-fungus, insect-fungi, and fungus-fungi Plays a key role in the interaction. [0003] The effective anti-parasitic effect of R.solani includes the expression of three endochitinases: 52kDa (CHIT52), 42kDa (CHIT42) and 33kDa (CHIT33), as well as...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/56C12N9/24C12N9/42A01N63/04A01P3/00C12R1/885
Inventor杨合同扈进冬陈凯李纪顺吴远征
OwnerBIOTECH CENT OF SHANDONG ACAD OF SCI