Flavivirus-detecting gene chip probe and gene chip detection method

A gene chip and flavivirus technology, which is applied in the field of flavivirus virus gene chip detection, can solve the problems of false positives, false negatives, interference with effective amplification of virus genomes, etc., to reduce interference, improve specificity and accuracy , the effect of shortening the experiment time

Inactive Publication Date: 2010-07-21
MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The common problem at present is that the detection results are prone to false positive or false negative when using the gene chip method to detect pathogens
The reason lies in the amplification method of the virus gene. At present, the random PCR amplification method is commonly used. Because the virus has the characteristics of intracellular parasitic, the DNA and RNA of the host cell will inevitably be extracted during the RNA extraction process. The genome of eukaryotes is usually larger than The viral genome is dozens of times larger, and in the subsequent random amplification process, the genes with high content will be amplified preferentially, which interferes with the effective amplification of the viral genome, resulting in false positive or false negative test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Flavivirus-detecting gene chip probe and gene chip detection method
  • Flavivirus-detecting gene chip probe and gene chip detection method
  • Flavivirus-detecting gene chip probe and gene chip detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1: the preparation of the gene chip that detects flavivirus genus virus

[0038] 1. Design pathogen-specific probes: Search the gene sequences of various viruses from Genbank, including the full genes of Tick borne encephalitis virus, Dengue virus, and Japanese encephalitis virus sequence. Clustal.83 was used to compare and analyze the sequences of each virus, and design virus-specific reverse transcription primers. The sequence of the reverse transcription primers is as described in SEQ ID No.16 in the sequence table. Then, the conserved sequence within the species was determined, the detection probe was designed with Array designer 4.0 software for the conserved sequence, and the probe sequence with strong specificity was selected through sequence comparison analysis of the probe in Genbank. The number of probes determined for each virus is 5, and the length is about 50bp. The probe sequence is as described in SEQ ID No.1 to SEQ ID No.15 in the sequence l...

Embodiment 2

[0041] Embodiment 2: detect flavivirus with the gene chip prepared in embodiment 1

[0042] 1. Viral nucleic acid extraction and cDNA synthesis

[0043] The RNA extraction of the virus was carried out according to the instructions of the RNA extraction kit (QIAGENE company product), and the RNA of BHK cells (purchased from ATCC) was extracted as a negative control. Viral RNA degrades the DNA molecules in it under the action of DNase I at 37°C for 20min. Then utilize flavivirus-specific primers to carry out reverse transcription, the primer sequence is as described in SEQ ID No.21, namely: 5'-3'GTTTCCCAGTAGGTCTCTTTCCCATGTT, AMV reverse transcriptase is the product of Fermentase company. React at 42°C for 1h. Then, under the action of Klenow enzyme (product of Fermentase Company), the second strand was synthesized using random primer 5'-GTTTCCCAGTAGGTCTCNNNNNNNN-3', and the reverse transcription of BHK cell RNA and the synthesis of the second strand were synthesized under the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a group of flavivirus-detecting gene chip probes and a general detection method. The probes include a Tick borne encephalitis probe, a Denguo virus probe and a Japanese encephalitis probe. A general primer sequence of flaviviruses capable of specific reverse transcription is designed, and flavivirus specific primers are utilized to perform reverse transcription for guiding the synthesis of viral genome so as to reduce interference in host cell gene components to the fullest extent and improve the specificity and accuracy of detection results. The invention can be used for the gene amplification of all flaviviruses and the gene chip detection of Tick borne encephalitis, Denguo virus and Japanese encephalitis.

Description

technical field [0001] The invention relates to a group of gene chip probes capable of detecting flaviviruses and a general detection method for flaviviruses gene chips. Background technique [0002] At present, detection methods for viral pathogens are still limited to traditional immunofluorescence detection, ELISA and PCR detection. Although they have good specificity, they can only detect one or several pathogens at the same time, which is time-consuming and laborious. Gene chip technology has the characteristics of fast and high-throughput. It can design detection probes for multiple viruses and spot them on the same chip to detect multiple pathogens. Compared with traditional methods, the detection efficiency can be greatly improved. [0003] At present, there are direct immunofluorescence method, indirect immunofluorescence method, real-time quantitative PCR method, RT-PCR detection method, etc. for the detection of dengue virus, Japanese encephalitis virus, forest e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11C12N15/10C12R1/93
CPCY02A50/30
Inventor康晓平杨银辉李永强刘洪孙庆歌祝庆余
OwnerMICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI