Flavivirus-detecting gene chip probe and gene chip detection method
A gene chip and flavivirus technology, which is applied in the field of flavivirus virus gene chip detection, can solve the problems of false positives, false negatives, interference with effective amplification of virus genomes, etc., to reduce interference, improve specificity and accuracy , the effect of shortening the experiment time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Embodiment 1: the preparation of the gene chip that detects flavivirus genus virus
[0038] 1. Design pathogen-specific probes: Search the gene sequences of various viruses from Genbank, including the full genes of Tick borne encephalitis virus, Dengue virus, and Japanese encephalitis virus sequence. Clustal.83 was used to compare and analyze the sequences of each virus, and design virus-specific reverse transcription primers. The sequence of the reverse transcription primers is as described in SEQ ID No.16 in the sequence table. Then, the conserved sequence within the species was determined, the detection probe was designed with Array designer 4.0 software for the conserved sequence, and the probe sequence with strong specificity was selected through sequence comparison analysis of the probe in Genbank. The number of probes determined for each virus is 5, and the length is about 50bp. The probe sequence is as described in SEQ ID No.1 to SEQ ID No.15 in the sequence l...
Embodiment 2
[0041] Embodiment 2: detect flavivirus with the gene chip prepared in embodiment 1
[0042] 1. Viral nucleic acid extraction and cDNA synthesis
[0043] The RNA extraction of the virus was carried out according to the instructions of the RNA extraction kit (QIAGENE company product), and the RNA of BHK cells (purchased from ATCC) was extracted as a negative control. Viral RNA degrades the DNA molecules in it under the action of DNase I at 37°C for 20min. Then utilize flavivirus-specific primers to carry out reverse transcription, the primer sequence is as described in SEQ ID No.21, namely: 5'-3'GTTTCCCAGTAGGTCTCTTTCCCATGTT, AMV reverse transcriptase is the product of Fermentase company. React at 42°C for 1h. Then, under the action of Klenow enzyme (product of Fermentase Company), the second strand was synthesized using random primer 5'-GTTTCCCAGTAGGTCTCNNNNNNNN-3', and the reverse transcription of BHK cell RNA and the synthesis of the second strand were synthesized under the ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com