Biomolecule competition analysis method and application thereof

An analysis method and biomolecular technology, applied in the field of biomolecular competition analysis, can solve problems such as not easy to achieve, and achieve the effect of easy realization

Inactive Publication Date: 2010-07-21
CHINA NAT ACAD NANOTECH & ENG
View PDF6 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, it is necessary to screen suitable monoclonal antibodies with consistent affinity for conjugates and small molecules for detection, and it is necessary to explore from various aspects such as antibody quality and antigen-antibody ratio. It can be seen that the establishment of ELISA methods for small molecule antigens is not easy to achieve.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: A kind of biomolecule competition analysis method, namely the chloramphenicol competition analysis method using nucleic acid aptamer as affinity ligand

[0027] Library synthesis and amplification:

[0028] The ssDNA library was prepared by chemical synthesis, with fixed sequences at both ends and a random sequence of 35 bases in the middle: 5'CCCCTGCAGGTGATTTTGTCCAAGT-(N35)-AGTATCGCTAATCAGGCGGAT3', with a library capacity of 10 14 Above; Primer 1: 5'CCCCTGCAGGTGATTTTGCTCAAGT 3', Primer 2: 5'ATCCGCCTGATTAGCGATACT 3'.

[0029] Using the ssDNA library synthesized above as a template, the ssDNA library was asymmetrically amplified with primer 1 and primer 2, that is, asymmetric PCR was used, the concentration ratio of primer 1 / primer 2 was 100:1, and the amplification conditions were: pre-denaturation at 94°C for 3 minutes, Then denature at 94°C for 30s, anneal at 65°C for 45s, cycle 35 times, extend at 72°C for 1min, and finally extend at 72°C for 7min. Th...

Embodiment 2

[0034] Example 2: A biomolecular competition analysis method, that is, a human CRP competition analysis method using nucleic acid aptamers as affinity ligands

[0035] A single-stranded DNA library containing 30 random sequences was synthesized by combinatorial chemistry: 5'-GTCACTGTCTTCATAGGTTG-N30-GAATCAGT GAGACATCCC 3', after purification on 8% denaturing polyacrylamide gel, primer 1 (5'-GTCACTGTCTTCATAGGTTG-3' ) and primer 2 (5'-TTCTAATACGACTCACTATAGGGGATGTCTCACTGATTC-3') amplification; use T7 in vitro transcription kit to transcribe and synthesize RNA, digest the DNA template with RNase-free DNase, extract with phenol-chloroform-isoamyl alcohol, and precipitate RNA with ethanol , purified with 8% denatured polyacrylamide gel after dissolving, which is the primary RNA library.

[0036] Label human CRP with colloidal gold according to the amount of protein: colloidal gold = 30μg: 1ml, centrifuge to remove the unbound part, wash and resuspend, coat the colloidal gold-labeled...

Embodiment 3

[0038] Example 3: A biomolecular competition analysis method, that is, a bisphenol A competition analysis method using nucleic acid aptamers as affinity ligands

[0039] Library synthesis and amplification:

[0040] The ssDNA library was prepared by chemical synthesis, with fixed sequences at both ends and a random sequence of 35 bases in the middle: 5'CCCCTGCAGGTGATTTTGTCCAAGT-(N35)-AGTATCGCTAATCAGGCGGAT3', with a library capacity of 10 14 Above; Primer 1: 5'CCCCTGCAGGTGATTTTGCTCAAGT 3', Primer 2: 5'ATCCGCCTGATTAGCGATACT 3'.

[0041] Using the ssDNA library synthesized above as a template, the ssDNA library was asymmetrically amplified with primer 1 and primer 2, that is, asymmetric PCR was used, the concentration ratio of primer 1 / primer 2 was 100:1, and the amplification conditions were: pre-denaturation at 94°C for 3 minutes, Then denature at 94°C for 30s, anneal at 65°C for 45s, cycle 35 times, extend at 72°C for 1min, and finally extend at 72°C for 7min. The obtained p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biomolecule competition analysis method which is characterized in that the competition analysis method is established by aptamer which serves as an affinity ligand, together with a marked target. The method includes the following steps: (1) coating the target aptamer; (2) combining with the marked target module through incubation; (3) adding a target sample for competition analysis; and (4) after washing, adding substrate for analysis. The method is particularly suitable for detecting small molecular antigens and haptens. The invention further aims to solve the technical problem in providing the application of the biomolecule competition analysis method. The biomolecule competition analysis method is widely applicable in the fields of in vivo and in vitro detection and analysis of morbid substances, experimental study of humoral biomolecules, food safety monitoring, biological terrorist prevention and monitoring and environmental monitoring.

Description

(1) Technical field: [0001] The invention belongs to the technical field of biological detection, in particular to a biomolecular competition analysis method and its application. (two) background technology: [0002] In 1971, enzyme-labeled reagents were prepared by using enzymes instead of isotopes, and the enzyme-linked immunoassay method (ELISA) was established. This method has the characteristics of sensitivity, specificity, simplicity, speed, stability, and ease of automatic operation. It has been widely used in various biological detection fields such as clinical diagnosis, biochemical analysis, food safety, and environmental monitoring. In principle, it is suitable for detecting all antigens, Antibodies and haptens for the direct quantitative determination of soluble antigens in body fluids. The basic mode is to adsorb known antigens or antibodies on the surface of a solid phase carrier (polystyrene micro-reaction plate), so that the antigen-antibody reaction is carr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N33/50G01N33/53C12Q1/68C40B20/00
Inventor吴淑庆弓景波杨在明
OwnerCHINA NAT ACAD NANOTECH & ENG