Biomolecule competition analysis method and application thereof
An analysis method and biomolecular technology, applied in the field of biomolecular competition analysis, can solve problems such as not easy to achieve, and achieve the effect of easy realization
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0026] Embodiment 1: A kind of biomolecule competition analysis method, namely the chloramphenicol competition analysis method using nucleic acid aptamer as affinity ligand
[0027] Library synthesis and amplification:
[0028] The ssDNA library was prepared by chemical synthesis, with fixed sequences at both ends and a random sequence of 35 bases in the middle: 5'CCCCTGCAGGTGATTTTGTCCAAGT-(N35)-AGTATCGCTAATCAGGCGGAT3', with a library capacity of 10 14 Above; Primer 1: 5'CCCCTGCAGGTGATTTTGCTCAAGT 3', Primer 2: 5'ATCCGCCTGATTAGCGATACT 3'.
[0029] Using the ssDNA library synthesized above as a template, the ssDNA library was asymmetrically amplified with primer 1 and primer 2, that is, asymmetric PCR was used, the concentration ratio of primer 1 / primer 2 was 100:1, and the amplification conditions were: pre-denaturation at 94°C for 3 minutes, Then denature at 94°C for 30s, anneal at 65°C for 45s, cycle 35 times, extend at 72°C for 1min, and finally extend at 72°C for 7min. Th...
Embodiment 2
[0034] Example 2: A biomolecular competition analysis method, that is, a human CRP competition analysis method using nucleic acid aptamers as affinity ligands
[0035] A single-stranded DNA library containing 30 random sequences was synthesized by combinatorial chemistry: 5'-GTCACTGTCTTCATAGGTTG-N30-GAATCAGT GAGACATCCC 3', after purification on 8% denaturing polyacrylamide gel, primer 1 (5'-GTCACTGTCTTCATAGGTTG-3' ) and primer 2 (5'-TTCTAATACGACTCACTATAGGGGATGTCTCACTGATTC-3') amplification; use T7 in vitro transcription kit to transcribe and synthesize RNA, digest the DNA template with RNase-free DNase, extract with phenol-chloroform-isoamyl alcohol, and precipitate RNA with ethanol , purified with 8% denatured polyacrylamide gel after dissolving, which is the primary RNA library.
[0036] Label human CRP with colloidal gold according to the amount of protein: colloidal gold = 30μg: 1ml, centrifuge to remove the unbound part, wash and resuspend, coat the colloidal gold-labeled...
Embodiment 3
[0038] Example 3: A biomolecular competition analysis method, that is, a bisphenol A competition analysis method using nucleic acid aptamers as affinity ligands
[0039] Library synthesis and amplification:
[0040] The ssDNA library was prepared by chemical synthesis, with fixed sequences at both ends and a random sequence of 35 bases in the middle: 5'CCCCTGCAGGTGATTTTGTCCAAGT-(N35)-AGTATCGCTAATCAGGCGGAT3', with a library capacity of 10 14 Above; Primer 1: 5'CCCCTGCAGGTGATTTTGCTCAAGT 3', Primer 2: 5'ATCCGCCTGATTAGCGATACT 3'.
[0041] Using the ssDNA library synthesized above as a template, the ssDNA library was asymmetrically amplified with primer 1 and primer 2, that is, asymmetric PCR was used, the concentration ratio of primer 1 / primer 2 was 100:1, and the amplification conditions were: pre-denaturation at 94°C for 3 minutes, Then denature at 94°C for 30s, anneal at 65°C for 45s, cycle 35 times, extend at 72°C for 1min, and finally extend at 72°C for 7min. The obtained p...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com