Supercharge Your Innovation With Domain-Expert AI Agents!

Streptavidin/interleukin-7 fusion protein

A technology of interleukin and fusion protein, applied in the field of interleukin-7, which can solve the problems of inability to make autologous tumor cell vaccines, low modification efficiency, and time-consuming preparation of autologous tumor cell vaccines

Inactive Publication Date: 2011-01-12
WENZHOU MEDICAL UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the preparation of tumor cell vaccines by gene modification has the following inherent defects: the efficiency of modification is generally low (especially in situ gene transfection or transduction), and depends on the type of tumor cells; It is difficult to achieve the effective concentration of the protein expression product locally and maintain it for a long time, so the actual anti-tumor clinical effect is very limited; due to individual differences and the inconsistency of the survival status of tumor cells when obtaining tumor samples, some patients often fail to provide survival information. Tumor cells in good condition cannot eventually be made into autologous tumor cell vaccines; there are often potential viral vector safety issues (so-called "genotoxicity") and immunogenicity issues (repeated use of the same viral vector will affect the expression efficiency of the introduced gene ); it is difficult to efficiently express multiple synergistic immunostimulatory factors at the same time, and to precisely control their expression
In addition, the preparation of genetically modified autologous tumor cell vaccines is time-consuming, and it is not easy to carry out large-scale and widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptavidin/interleukin-7 fusion protein
  • Streptavidin/interleukin-7 fusion protein
  • Streptavidin/interleukin-7 fusion protein

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0027] Preparation of Example 1 Fusion Protein IL7-L-SA-6His

[0028] 1. Use the DNeasy tissue kit to extract bacterial genomic DNA from Streptomyces avidin, and then use it as a template,

[0029] Mature streptavidin cDNA was prepared by PCR with Platinum pfx DNA polymerase.

[0030] Primer: 5'GGAATTCTCAAGCGGGGGCAGCGGGGGCGGAGGCAGCGGCGGGGGCGGATCCGCCGACCCCTCCAAGGACTCGAAGGCC 3'(78nt) and

[0031] 5'GTGGTGCTCGAGCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (39nt).

[0032] Reaction conditions: denaturation at 94°C, 2min, 25 cycles (94°C, 15s→60°C, 15s→68°C, 30s), and finally 68°C, 5min.

[0033] 2. Extract the total RNA of PHA-activated peripheral blood lymphocytes with Trizol, and use it as a template to prepare mature IL-7 cDNA by RT-PCR.

[0034]Primers: 5'CGGGATCCCATATGGATTGTGATATTGAAGGTAAAG 3'(36nt) and

[0035] 5'CGGAATTCGTGTTCTTTTAGTGCCCATC3' (27nt)

[0036] Reaction conditions: denaturation at 94°C, 2min, 25 cycles (94°C, 15s→60°C, 15s→68°C, 30s), and finally 68°C, 5min.

[0037] ...

example 2

[0051] Preparation of example 2 fusion protein 6His-SA-L-IL7

[0052] 1. Preparation of mature streptavidin cDNA: the method is the same as in Example 1.

[0053] Primers:

[0054] 5'GGAATTCCATATGCATCATCACCATCACCATGAGGCCGGCATCACCGGCACCTGG3' (55nt) and

[0055] 5' GGAATTCGGCGGATCCGCCCCCGCCGCTGCCTCCGCCCCCGCTGCCCCCGCTCGTCTGCTGAACGGCGTCGAGCGGGTTGCC 3' (82nt).

[0056] 2. Preparation of mature IL-7 cDNA: the method is the same as in Example 1.

[0057] Primers:

[0058] 5'CGGGATCCGATTGTGATATTGAAGGT 3'(26nt)

[0059] and 5'CGCTCGAGTCAGTGTTTCTTTAGTGCC 3' (26nt).

[0060] 3. Construction of 6His-SA-L-IL7-pET24 recombinant plasmid

[0061] Prepared SA cDNA (without termination code, containing NdeI and BamHI restriction endonuclease sites at both ends) and IL-7 cDNA (respectively containing BamHI and XhoI restriction endonuclease sites at both ends), the above SA and The IL-7 gene fragment was cloned in pET-24a

[0062] In the vector, obtain the 6His-SA-L-IL7-pET24 recombinant ...

example 3I

[0068] Preparation of the tumor vaccine modified by example 3 IL7-L-SA-6His or 6His-SA-L-IL7 fusion protein

[0069] will be 10 7 Suspend B16.F10 cells in 1ml 1×PBS, add 0.5mg Sulfo-NHS-LC-Biotin and mix well, then act at room temperature for 30 minutes; wash the cells 3 times with 1×PBS, 6 Add 200ng IL7-L-SA-6His or 6His-SA-L-IL7 fusion protein to each B16.F10 cell, and act on ice for 30 minutes; wash the cells once with 1×PBS, and then inactivate them with γ-rays (20000rad). .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a fusion protein which is formed by connecting adapter peptide withstreptavidin and interleukin-7. The amino acid sequence of the adapter peptide is Ser Ser Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser. The fusion protein of the invention simultaneously has the activity of the streptavidin and the interleukin-7; the interleukin-7 is anchored on the surface of the cancer cell of the biotinylation through the adhesive bond of the streptavidin and biotin; the fusion protein can stably exist on the surface of gamma radial inactivation cancer cell, and still keep the activity of the interleukin-7. The tumor vaccine surface-decorated by the fusion protein in the invention surface has the functions of preventing and curing the tumour, and can be used for preparing the vaccines preventing and curing the tumours.

Description

technical field [0001] The present invention relates to the fields of genetic engineering and protein engineering, in particular to polypeptides derived from animals, especially interleukin-7. Background technique [0002] Interleukin-7 (IL-7) is a cytokine produced by stromal cells that regulates the differentiation, proliferation and activation of lymphocytes and macrophages. The main function is to promote the growth of pre-B cells. It is not only an important growth factor in the differentiation and maturation of T and B lymphocytes, but also a moving factor for pluripotent stem cells and myeloid precursor cells. At the same time, IL-7 can also promote the growth of T cells. Cell function, induce monocyte-macrophages to express various cytokines. Therefore, IL-7 has the functions of anti-tumor and enhancing immune function of the body. The IL-7 gene is used to modify tumor cells and prepare tumor cell vaccines to enhance the immunogenicity of tumor antigens. The thera...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21A61K39/00A61P35/00C12R1/19
Inventor 高基民张振许晓玲
Owner WENZHOU MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com