Edwardsiella tarda surface display type vaccine and preparation and application thereof
A delayed Edwardian, surface display technology, applied in the field of molecular immunology, can solve the problem of fewer vaccines, and achieve the effect of simple preparation and high protective effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] The Edwardsiella tarda vaccine is shown by the base sequence in SEQ ID No. 1 of the sequence table (see sequence table 1).
[0021] Sequence Listing 1
[0022] ATGGCGATGAAAAAGTTGCTCTTAGCGTCGCTGCTGTTTGGCAGCGCAACCGTATACGGTGCAGATGGTTTCGTAGTGAA
[0023] AAATATTCATTTCGAAGGACTGCAGCGGGTCGCCGTCGGTGCGGCGTTACTTAACATGCCGGTACGCGTAGGCGATACCG
[0024] TCTCTGATGAGGATCTGAGTAATACCATCCGCGCGCTGTACGCCACCGGTAACTTTGAGGATGTGCGGGTACTGCGTGAT
[0025] GGTAACAATCTGATTGTGCAGGTTAAGGAACGCCCGACGATCGCCAGCATTACCTTCTCTGGCAACAAGTCAGTGAAGGA
[0026] CGAGATGCTAAAGCAGAACCTGGAGGCCTCCGGGGTTCGCGTCGGCGAGGCGCTCGATCGCACCACGTTATCCAGCATTG
[0027] AAAAAGGGCTGGAGGATTTCTACTACAGCGTCGGTAAATACAACGCCACCGTGAAGGCCGTTGTTACACCGCTGCCGCGC
[0028] AATCGCGTCGATCTGAAGCTGGTGTTTACCGAGGGTAAATCGGCGCAGATCCAGCAGATTAATATCGTCGGCAACCATGC
[0029] GTTCAGCAGCGCCGAGCTGCTGGGGCACTTCCAGCTGCGCGACGATGTACCGTGGTGGAACCTGATGGCCGATCGCAAAT
[0030] ACCAGAAGCAGAAGCTGGCCGGCGACCTTGAGGCGCTGCGCAGCTACTATCTGGATCGCGGCTACGCGCGTTTCGCCATT
[0031] AATTCGA...
Embodiment 2
[0064] The construction method of surface display type Edwardsiella tarda vaccine:
[0065] Construction of strain DH5α / pSA1: use Edwardsiella tarda TX1 as template and F1 / R1 as primers for PCR amplification. The PCR conditions are: 94°C for 60s to pre-denature the template DNA, then 94°C for 40s, 50°C for 60s, and 72°C 60s, after 5 cycles, change to 94°C for 40s, 60°C for 60s, 72°C for 60s, after 25 cycles, extend the reaction at 72°C for 10min. The PCR product was purified with the Tiangen DNA Product Purification Kit and recovered by NdeI / XhoI double enzyme digestion to recover 2.3kb for use; then the plasmid pBT3 was recovered by NdeI / XhoI double enzyme digestion to recover a 4.5kb fragment. For the construction process of the plasmid pBT3, see Zhang W, Sun K, Cheng S, Sun L.Characterization of DegQ Vh , a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008; 74: 6254 62.; The two recovered fragments were ligated ...
Embodiment 3
[0069] Application of Edwardsiella tarda vaccine
[0070] Step 1) Preparation of vaccine preparation solution and vaccine control solution. The vaccine expression strain DH5α / pSA1 obtained above was cultured overnight in LB liquid medium containing 50ug / ml Ap; take 0.1ml of overnight culture solution, add it to 10ml fresh LB liquid culture containing Ap (50ug / ml) culture medium at 37°C with shaking at 180rpm until OD 600 0.8-1, then centrifuge the culture solution (5000g, 4°C, 10min), collect the bacteria, suspend it in PBS to a final concentration of 1×10 8 cfu / ml is the vaccine preparation solution.
[0071] The PBS composition is by weight percentage: 0.8% NaCl, 0.02% KCl, 0.358% Na 2 HPO 4 .12H 2 O, 0.024% NaH 2 PO 4 .
[0072] Step 2) Immunization injection of the vaccine. 50 flounder (each weighing about 9.1g) were randomly divided into 2 groups, 25 in each group. These two groups are named A and B respectively. Each fish in group A was injected intraperitonea...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap