Edwardsiella tarda surface display type vaccine and preparation and application thereof

A delayed Edwardian, surface display technology, applied in the field of molecular immunology, can solve the problem of fewer vaccines, and achieve the effect of simple preparation and high protective effect

Inactive Publication Date: 2014-02-26
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, due to various reasons, most vaccines against Edwardsiella tarda are in the stage of laboratory research, and few vaccines are actually used in industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Edwardsiella tarda surface display type vaccine and preparation and application thereof
  • Edwardsiella tarda surface display type vaccine and preparation and application thereof
  • Edwardsiella tarda surface display type vaccine and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The Edwardsiella tarda vaccine is shown by the base sequence in SEQ ID No. 1 of the sequence table (see sequence table 1).

[0021] Sequence Listing 1

[0022] ATGGCGATGAAAAAGTTGCTCTTAGCGTCGCTGCTGTTTGGCAGCGCAACCGTATACGGTGCAGATGGTTTCGTAGTGAA

[0023] AAATATTCATTTCGAAGGACTGCAGCGGGTCGCCGTCGGTGCGGCGTTACTTAACATGCCGGTACGCGTAGGCGATACCG

[0024] TCTCTGATGAGGATCTGAGTAATACCATCCGCGCGCTGTACGCCACCGGTAACTTTGAGGATGTGCGGGTACTGCGTGAT

[0025] GGTAACAATCTGATTGTGCAGGTTAAGGAACGCCCGACGATCGCCAGCATTACCTTCTCTGGCAACAAGTCAGTGAAGGA

[0026] CGAGATGCTAAAGCAGAACCTGGAGGCCTCCGGGGTTCGCGTCGGCGAGGCGCTCGATCGCACCACGTTATCCAGCATTG

[0027] AAAAAGGGCTGGAGGATTTCTACTACAGCGTCGGTAAATACAACGCCACCGTGAAGGCCGTTGTTACACCGCTGCCGCGC

[0028] AATCGCGTCGATCTGAAGCTGGTGTTTACCGAGGGTAAATCGGCGCAGATCCAGCAGATTAATATCGTCGGCAACCATGC

[0029] GTTCAGCAGCGCCGAGCTGCTGGGGCACTTCCAGCTGCGCGACGATGTACCGTGGTGGAACCTGATGGCCGATCGCAAAT

[0030] ACCAGAAGCAGAAGCTGGCCGGCGACCTTGAGGCGCTGCGCAGCTACTATCTGGATCGCGGCTACGCGCGTTTCGCCATT

[0031] AATTCGA...

Embodiment 2

[0064] The construction method of surface display type Edwardsiella tarda vaccine:

[0065] Construction of strain DH5α / pSA1: use Edwardsiella tarda TX1 as template and F1 / R1 as primers for PCR amplification. The PCR conditions are: 94°C for 60s to pre-denature the template DNA, then 94°C for 40s, 50°C for 60s, and 72°C 60s, after 5 cycles, change to 94°C for 40s, 60°C for 60s, 72°C for 60s, after 25 cycles, extend the reaction at 72°C for 10min. The PCR product was purified with the Tiangen DNA Product Purification Kit and recovered by NdeI / XhoI double enzyme digestion to recover 2.3kb for use; then the plasmid pBT3 was recovered by NdeI / XhoI double enzyme digestion to recover a 4.5kb fragment. For the construction process of the plasmid pBT3, see Zhang W, Sun K, Cheng S, Sun L.Characterization of DegQ Vh , a serine protease and a protective immunogen from a pathogenic Vibrio harveyi strain. Appl Environ Microbiol 2008; 74: 6254 62.; The two recovered fragments were ligated ...

Embodiment 3

[0069] Application of Edwardsiella tarda vaccine

[0070] Step 1) Preparation of vaccine preparation solution and vaccine control solution. The vaccine expression strain DH5α / pSA1 obtained above was cultured overnight in LB liquid medium containing 50ug / ml Ap; take 0.1ml of overnight culture solution, add it to 10ml fresh LB liquid culture containing Ap (50ug / ml) culture medium at 37°C with shaking at 180rpm until OD 600 0.8-1, then centrifuge the culture solution (5000g, 4°C, 10min), collect the bacteria, suspend it in PBS to a final concentration of 1×10 8 cfu / ml is the vaccine preparation solution.

[0071] The PBS composition is by weight percentage: 0.8% NaCl, 0.02% KCl, 0.358% Na 2 HPO 4 .12H 2 O, 0.024% NaH 2 PO 4 .

[0072] Step 2) Immunization injection of the vaccine. 50 flounder (each weighing about 9.1g) were randomly divided into 2 groups, 25 in each group. These two groups are named A and B respectively. Each fish in group A was injected intraperitonea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the field of molecular immunology, in particular to an Edwardsiella tarda surface display type vaccine and preparation and application thereof. The surface display type vaccine is shown as a base sequence in a sequence table SEQ ID No.1. The preparation method comprises the following steps of: performing polymerase chain reaction (PCR) by using a primer F1 / R1 and by taking Edwardsiella tarda TX1 as a template; and connecting a PCR product with a plasmid pBT3, and transforming Escherichia coli by using connection liquid to obtain a coded vaccine strain of Edwardsiella tarda vaccine protein for expressing the base sequence in the sequence table SEQ ID No.1. The vaccine strain of the Edwardsiella tarda vaccine protein coded by the base sequence in the sequence table SEQ ID No.1 has the effect of inhibiting Edwardsiella tarda. The vaccine is easy to prepare, is not required to be subjected to any processes such as extraction, purification and inactivation, and does not need any adjuvant when used.

Description

technical field [0001] The invention relates to the field of molecular immunology, in particular to a surface-displayed vaccine of Edwardsiella tarda and its preparation and application. Background technique [0002] Edwardsiella tarda is a Gram-negative bacterium belonging to the genus Edwardsiella. The bacterium is an opportunistic human / fish zoonotic pathogen that can infect humans and a variety of fish, including flounder, turbot, red sea bream, and tilapia. Edwardsiella tarda is an important pathogen of fish worldwide and causes great economic losses to the aquaculture industry every year. In my country and many other countries, the prevention and treatment of tardive Edwardsiella mainly depends on the use of antibiotics. However, the extensive use of antibiotics has led to many adverse consequences, including environmental pollution and the emergence of drug-resistant strains. Due to its safety and environmental friendliness, vaccines have become recognized as the m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): A61K39/02C12N1/21C12N15/31A61P31/04
Inventor 孙黎孙云
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap