Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains

A technology of Mycoplasma hyopneumoniae and porcine circovirus, which is applied in the biological field, can solve the problems of restricting the popularization and use of vaccines, high cost of vaccine production, special immunization routes, etc., and achieves the effects of remarkable immunization effect, manpower saving, and good immunization safety.

Active Publication Date: 2011-06-01
兆丰华生物科技(南京)有限公司 +2
View PDF1 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The infection rate of mycoplasma hyopneumoniae in China has reached 70%. The control of the disease currently involves drug treatment and vaccine immunization. Antibiotic treatment has the problem of drug resistance. At present, the main prevention and control measures are vaccine immunization, and the main international vaccine is inactivated vaccine, but the use of this vaccine cannot completely resist the re-infection of Mycoplasma pneumoniae. The main domestic vaccine is attenuated vaccine. The immune effect of this vaccine is obvious, but the main problem is that the production cost of this vaccine is high, and the immune route is special Seriously restrict the popularization and use of the vaccine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains
  • Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains
  • Construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Construction of porcine circovirus type II-mycoplasma hyopneumoniae prokaryotic expression strain

[0036] (1) Amplification and cloning of PCV2CAP gene and Mhp R1 gene

[0037] A. Primer design

[0038] According to the whole genome sequence of PCV2 in Genebank, primers were designed to express the ORF2 gene sequence of CAP protein, and a restriction site was added to the designed primer according to the restriction site of the selected prokaryotic expression vector pET-28a (+), Its primer sequence is as follows:

[0039] CAP-P1: 5'CAAGCTTGCATGACGTATCCAAGGA'3

[0040] CAP-P2: 5'GTGCGGCCGCTTAAGGGTTAAGTGG'3

[0041] Design the primers of the gene sequence of the repeat region R1 according to the whole genome sequence of Mhp in Genebank, and add restriction sites in the designed primers according to the restriction sites of the selected prokaryotic expression vector pET-28a (+), Its primer sequence is as follows:

[0042] R1-P1: 5'GCGGATCCGCAGCAAAACCAGAAGC'...

Embodiment 2

[0053] Example 2 Induction and mass production of expression product of porcine circovirus type II-mycoplasma hyopneumoniae prokaryotic expression strain

[0054] (1) Induced expression of prokaryotic expression strains

[0055] The screened positive bacteria were screened for induction. Method: a. Inoculate 5 mL of 2xYT medium with Kan resistance with the preserved bacterial solution at a ratio of 1:1000, and culture overnight at 37°C for 14 hours. One tube of empty plasmid bacteria should be inoculated as a control. b The next day, inoculate the overnight cultured fresh bacteria into 5mL 2xYT medium with Kan resistance at a ratio of 1:1000, inoculate two tubes for each bacteria, one for induction and one for non-induced control, at 37°C Cultivate for 3h. Make OD 600nm The value reaches 0.4-0.5. c Then one of the tubes was added with inducer IPTG to make the final concentration 1mmol / l, and cultured at 37°C for 5h. d Take 1.5 mL of each bacteria into an eppendorf tube, ...

Embodiment 3

[0062] Example 3 Vaccine preparation of porcine circovirus type II-mycoplasma hyopneumoniae prokaryotic expression strain expression product

[0063] (1) Preparation of antigens for production

[0064] The protein prepared according to Example 2 was used as an antigen for vaccine production.

[0065] (2) Emulsification of antigen

[0066] The antigen for production is added into the oil adjuvant according to the ratio of 1:1 (antigen: oil adjuvant), and emulsified to obtain the experimental vaccine.

[0067] The oil adjuvant used is prepared as 90wt% white oil and 10wt% Siben-80. Aluminum stearate is added to the oil adjuvant mixed solution, wherein the amount of aluminum stearate added is 1 g / 100 ml oil adjuvant mixed solution . In this example, a total of 1 batch of porcine circovirus type II-Mycoplasma hyopneumoniae vaccines were prepared, and the prepared vaccines passed the physical property inspection, safety inspection, and efficacy inspection.

[0068] The quality ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to construction and application of porcine circovirus type II-porcine mycoplasma pneumoniae expressing strains and belongs to the technical field of biology. By a method provided by the invention, prokaryotic expression engineering strains of expressing porcine circovirus type II-porcine mycoplasma pneumoniae major antigenic protein are constructed. The strains can simultaneously express the major antigenic protein R1 of porcine mycoplasma pneumoniae and a major antigenic protein catabolite activator protein (CAP) of porcine circovirus, purified recombinant protein can stimulate organisms to produce a protective immune response which resists attacks of porcine circovirus type II and the porcine mycoplasma pneumoniae, and the infection of the porcine circovirus and the porcine mycoplasma pneumoniae can be effectively prevented.

Description

technical field [0001] The invention relates to the construction and application of porcine circovirus type II-mycoplasma hyopneumoniae expression strain, and belongs to the field of biotechnology. Background technique [0002] Porcine circovirus type II (Porcine circovirus 2, PCV2) can cause multisystemic wasting syndrome (PMWS) in weaned piglets, including porcine dermatitis and nephritic syndrome (PDNS), proliferative necrotizing pneumonia (PNP), porcine respiratory syndrome (PRDC) and other diseases; the main clinical features are progressive weight loss, weakness, dyspnea, and enlarged lymph nodes, sometimes with diarrhea, pallor, and jaundice. The morbidity and mortality of the disease vary greatly, and the mortality rate can reach more than 15% in acute outbreaks; the main pathological changes are lymphocyte loss, histiocyte infiltration of lymphoid tissue, interstitial pneumonia, different degrees of hepatitis and Interstitial nephritis. At present, PCV2 has been w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/62C12N15/70C12N1/21A61K39/02A61K39/108C12R1/19
Inventor 卢会英杜金玲赵亚荣
Owner 兆丰华生物科技(南京)有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More