Xenopus tropicalis interleukin 8 cDNA, cloning method and recombination application thereof
A technology of interleukin and Xenopus laevis, applied in the field of biogenetic engineering, can solve problems such as being completely blank
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Xenopus laevis; donated by Professor Cao Ying from the Institute of Model Animals, Nanjing University.
[0031] (1) Primer design: Analyze the Xenopus laevis interleukin-8 cDNA conserved region obtained from human, mouse, chicken, duck, goose, and electronic clones by Clustal w software, and design specific primers:
[0032] XtIL-8F: 5'-ATGGAAACCAAGAGAAGTGTCCTG-3' (SEQ ID NO.3)
[0033] XtIL-8R: 5'- TTAAAGAGCAGAAACAGGTGTCT-3' (SEQ ID NO.4)
[0034](2) Extraction of total RNA: RNA extraction reagent TRIzol (Invitrogen Company) was used to extract total RNA from Xenopus laevis spleen cells according to its operation manual, and its quality and purity were identified by formaldehyde-denatured agarose gel electrophoresis, and UV spectrophotometer Determine its concentration.
[0035] (3) RT-PCR: PCR amplification was performed using the above-mentioned XtIL-8F and XtIL-8R as primers to obtain a 312bp fragment.
[0036] ① reverse transcription
[0037] In the DEPC-treate...
Embodiment 2
[0043] Analysis of the expression level of Xenopus laevis IL-8 gene in various tissues:
[0044] Using the method for extracting RNA in Example 1, total RNA was extracted from Xenopus laevis heart, liver, spleen, lung, and intestine, and reversed with reverse transcriptase Recorded into cDNA, using GAPDH as an internal reference, the expression level of Xenopus laevis IL-8 gene in various tissues was studied by real time-PCR method.
[0045] The amplification primers for the target gene are: XtIL-8SF: 5'- AAAGCATCCCAGTGTCAAGG -3' (SEQ ID NO.5); XtIL-8SR: 5'- ATCGTCCCCCACTTGTCAAAG -3' (SEQ ID NO.6); GAPDH amplification The primers are XtGAPDH1: 5'-ACCCAGAAGACAGTGGATGG-3' (SEQ ID NO.7); XtGAPDH2: 5'- GGAAAGCCATTCCGGTTATT C-3' (SEQ ID NO.8). With DEPC water as the blank control, three replicate holes were made for each sample. The reaction system is: Mix 12.5 μl, H 2 O 9.5 μl, Primer1 1 μl, Primer2 1 μl, templete 1 μl. The reaction program is: 95 °C / 3 min, 40 cycles (95 °C / 30...
Embodiment 3
[0058] The Xenopus laevis cDNA obtained in Example 1 is used to produce recombinant Xenopus tropicalis IL-8 through existing genetic engineering methods, as an amphibian immune enhancer to improve the ability of these species to resist microbial and viral infections.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com