Supercharge Your Innovation With Domain-Expert AI Agents!

Xenopus tropicalis interleukin 8 cDNA, cloning method and recombination application thereof

A technology of interleukin and Xenopus laevis, applied in the field of biogenetic engineering, can solve problems such as being completely blank

Inactive Publication Date: 2011-07-13
NANJING NORMAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003]According to the search results of three major international nucleic acid sequence databases, Genebank, EMBL, and DDBJ, so far human, mouse, pig (mammal) chicken, duck, The IL-8 cDNAs of pigeons (birds), salmon, river catfish, black-lined fish (fish), Chinese soft-shell turtle (reptiles), etc. have been cloned, and the sequence numbers have been applied for in the GenBank database respectively, while So far, the cDNA of Xenopus interleukin 8 (XtIL-8), which is a representative of amphibians in model organisms, has not been cloned, and the research on Xenopus IL-8 gene is still completely blank at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xenopus tropicalis interleukin 8 cDNA, cloning method and recombination application thereof
  • Xenopus tropicalis interleukin 8 cDNA, cloning method and recombination application thereof
  • Xenopus tropicalis interleukin 8 cDNA, cloning method and recombination application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Xenopus laevis; donated by Professor Cao Ying from the Institute of Model Animals, Nanjing University.

[0031] (1) Primer design: Analyze the Xenopus laevis interleukin-8 cDNA conserved region obtained from human, mouse, chicken, duck, goose, and electronic clones by Clustal w software, and design specific primers:

[0032] XtIL-8F: 5'-ATGGAAACCAAGAGAAGTGTCCTG-3' (SEQ ID NO.3)

[0033] XtIL-8R: 5'- TTAAAGAGCAGAAACAGGTGTCT-3' (SEQ ID NO.4)

[0034](2) Extraction of total RNA: RNA extraction reagent TRIzol (Invitrogen Company) was used to extract total RNA from Xenopus laevis spleen cells according to its operation manual, and its quality and purity were identified by formaldehyde-denatured agarose gel electrophoresis, and UV spectrophotometer Determine its concentration.

[0035] (3) RT-PCR: PCR amplification was performed using the above-mentioned XtIL-8F and XtIL-8R as primers to obtain a 312bp fragment.

[0036] ① reverse transcription

[0037] In the DEPC-treate...

Embodiment 2

[0043] Analysis of the expression level of Xenopus laevis IL-8 gene in various tissues:

[0044] Using the method for extracting RNA in Example 1, total RNA was extracted from Xenopus laevis heart, liver, spleen, lung, and intestine, and reversed with reverse transcriptase Recorded into cDNA, using GAPDH as an internal reference, the expression level of Xenopus laevis IL-8 gene in various tissues was studied by real time-PCR method.

[0045] The amplification primers for the target gene are: XtIL-8SF: 5'- AAAGCATCCCAGTGTCAAGG -3' (SEQ ID NO.5); XtIL-8SR: 5'- ATCGTCCCCCACTTGTCAAAG -3' (SEQ ID NO.6); GAPDH amplification The primers are XtGAPDH1: 5'-ACCCAGAAGACAGTGGATGG-3' (SEQ ID NO.7); XtGAPDH2: 5'- GGAAAGCCATTCCGGTTATT C-3' (SEQ ID NO.8). With DEPC water as the blank control, three replicate holes were made for each sample. The reaction system is: Mix 12.5 μl, H 2 O 9.5 μl, Primer1 1 μl, Primer2 1 μl, templete 1 μl. The reaction program is: 95 °C / 3 min, 40 cycles (95 °C / 30...

Embodiment 3

[0058] The Xenopus laevis cDNA obtained in Example 1 is used to produce recombinant Xenopus tropicalis IL-8 through existing genetic engineering methods, as an amphibian immune enhancer to improve the ability of these species to resist microbial and viral infections.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses xenopus tropicalis interleukin 8 (XtIL-8) cDNA, a cloning method and recombination application thereof, relating to the field of biological genetic engineering. A gene of the XtIL-8 cDNA has a sequence shown in SEQ ID NO.1. The cloning method comprises the steps of: extracting total xenopus tropicalis spleen RNA by using a TRIzol method and carrying out reverse transcription; analyzing an XtIL-8 cDNA conversed region obtained from cloning of human, chicks, ducks, geese and electronics through Clustalw software, designing a specific primer for carrying out PCR (Polymerase Chain Reaction) amplification to obtain a 312bp amplification segment which is a full-length sequence of the XtIL-8 through sequencing. The XtIL-8 cDNA can be used for producing a recombinant XtIL-8 as an immune potentiator for amphibians through the traditional genetic engineering method.

Description

technical field [0001] The invention relates to the field of biogenetic engineering, in particular to Xenopus tropicalis IL-8 cDNA and its cloning and expression technology. Background technique [0002] Interleukin 8 (IL-8), the first chemokine discovered in 1987, was named monocyte-derived neutrophil chemokine at that time and plays an important role in inflammation. In recent years, with the discovery of other chemotactic substances, the biological activity of IL-8 has been further confirmed. In inflammatory diseases, there are a large number of leukocytes in the inflammatory focus. IL-8 has chemical stimulation and chemotactic effects on leukocytes, enhances the ability of leukocytes to migrate, and enhances the immune response of leukocytes to anti-infection. Moreover, studies have shown that the expression of IL-8mRNA is accompanied by the occurrence of the disease, and rises and falls with the outcome of the disease. The latest research shows that IL-8 plays an impo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/24C12N15/10C12N15/09A61K38/20A61P37/04C07K14/54
Inventor 张双全崔县伟
Owner NANJING NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More