Soluble VEGFR (Vascular Endothelial Growth Factor Receptor) difunctional chimera receptor VEGFR31-Ig as well as preparation method and application thereof
A VEGF-B, vegfr31-ig technology, applied in chemical instruments and methods, antibodies, hybrid peptides, etc., can solve the problems of poor treatment effect, unrealized metastasis, and poor prognosis of malignant tumors.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Example 1. Cloning of Human Antibody Light and Heavy Chain Constant Regions and Fc Region Genes
[0055] Isolate healthy human lymphocytes with lymphocyte separation medium, and extract total RNA with Trizol reagent (Invitrogen company product), according to literature (Cell, 1980, 22: 197-207) and literature (Nucleic Acids Research, 1982, 10: 4071-4079) Primers were designed to amplify the heavy chain and light chain constant region genes of the reported sequence, and the Fc region of the antibody was amplified with primers FC sense: GAAGCTTAATAATGGCCCGGGCGAGCCCAAATCTTGTGAC and FC antisense: CGAATTCTCATTTACCCGGAGACAGG. All PCR reactions were hot-started, and the reaction conditions were: 94°C for minutes; 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 1 minute and 10 seconds, 30 cycles; 72°C for 10 minutes. The PCR product was purified and recovered by agarose gel electrophoresis and cloned into the pGEM-T vector. After sequencing verification, it was confirmed tha...
Embodiment 2
[0056] Example 2. Construction of soluble bifunctional VEGFR fusion receptor VEGFR31-Ig
[0057] VEGFR12 and VEGFR23 genes were synthesized by Shanghai Bioengineering Technology Service Co., Ltd. according to the sequences in NM_002019 and NP_002244, and human antibody light chain constant region (k constant region) genes (using primers LC sense: ACTGTGGCTGCACCATCTGT; LC antisense: GAATTCCTAACACTCTCCCCTGTTG and pGEM-T / CL as a template) was ligated by overlapPCR (see SEQ ID NO: 3 for the sequence), and was cloned into the pGEM-T vector (Promega company product), positive clones were selected, sequenced correctly, and digested with HinDIII and EcoRI ( Promega company product), purified and recovered by agarose gel electrophoresis to obtain a 1 kb restriction enzyme fragment and isoenzyme-digested plasmid pDR1 ( figure 1 ) were ligated with T4 DNA ligase (product of Invitrogen Company) to construct eukaryotic expression vector pDR (VEGFR31-Ig-L). Figure 5 It is the gene structu...
experiment example 1
[0061] Experimental example 1. Affinity detection experiment of soluble bifunctional VEGFR fusion receptor-ELISA method
[0062] Experimental procedure: Dilute VEGF-A and VEGF-C (products of R&D Company) with 0.05mmol / L sodium carbonate-sodium bicarbonate buffer solution (pH 9.6) to 2ug / ml, 100ul / well, and coat overnight at 4°C. After blocking with 3% skimmed milk at room temperature for 2 hours, different concentrations of soluble VEGFR fusion receptors VEGFR31-Ig, VEGFRIg, and VEGFRIgM were added, 100ul / well, and three parallel wells were taken for each concentration. PBS was used as a negative control and incubated at room temperature for 2 hours. Discard the supernatant, wash with PBS three times, add HRP-labeled mouse anti-human IgG monoclonal antibody (product of DAKO Company) diluted according to the titer, 50ul / well, and incubate at room temperature for 45min. After fully washed with PBS, OPD was protected from light for color development, and 2mol / L H 2 SO 4 After t...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com