Acquired immune deficiency syndrome virus and treponema pallidum fusion protein as well as preparation method and application thereof
A technology of Treponema pallidum and HIV, which is applied in the field of immunological detection, can solve the problems of high total detection cost, time-consuming operation, inconvenient and other problems, and achieve the effect of low detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Preparation of Recombinant Fusion Protein Antigen of HIV and TP Genetic Engineering
[0049] (1) Acquisition of major dominant antigen genes of HIV-1 / 2 and TP
[0050] The complete gene sequences of HIV-1 and type 2 viruses were searched in the Genebank database, and the gene sequences of the main dominant antigens gp41, gp120, gp36, and gp125 were determined, the recombinant gene templates were obtained by artificial synthesis, and a large number of genes were obtained by PCR. The HIV gene template PCR primers are as follows:
[0051] Sense primer:
[0052] GGATCC AGTTAAAATCGAACCGCTG
[0053] Anti-sense primer:
[0054] AGCTT TCA CAGGTCTTTCTTCAGAGATCAGTTTCTGTTC GCACGGCGCGTAGTTA.
[0055] TP gene template PCR primers are as follows:
[0056] Sense primer:
[0057] GC GGATCC ATGTGTTTCTTGCACCACTGT
[0058] Anti-sense primer:
[0059] GC GAATTC TCA CAGGTCTTTCTTCAGAGATCAGTTTCTGTTC CGCTTCTTTTTCACCACG
[0060] in GGATCC for BamHI Restriction sites, ...
Embodiment 2
[0070] Preparation of immune colloidal gold probes for recombinant antigens of HIV and TP genetic engineering:
[0071] 1) Preparation of colloidal gold Referring to the trisodium citrate reduction method and microwave technology, the optimal ratio of gold chloride and trisodium citrate for the preparation of 40 nm colloidal gold particles was determined by electron microscope observation. The operation steps are briefly described as follows: Boil 100 mL of 0.1 g / L gold chloride in a microwave oven, and quickly add 10 g of freshly prepared / L trisodium citrate, when the color of the solution turns dark blue, place it in a microwave oven and continue heating for 5 min, then make up for the lost water after cooling at room temperature, 25mM K 2 CO 3 The pH of the colloidal gold solution was adjusted, filtered through a 0.22 μm filter membrane and stored at 4 °C for later use. At the same time, the particle size and particle uniformity were observed under an electron microscope...
Embodiment 3
[0076] Preparation of GICA one-step dual rapid detection of AIDS and syphilis antibody test strips:
[0077] 1) Soak the glass cellulose membrane (300×20 mm) in 0.01 mol / L pH 7.4 phosphate buffer (20 g BSA, 25 g trehalose, 3 g PVP-40, 0.2 g NaN 3, 8 g NaCl, 0.2 g KCl, 2.9 g NaCl 2 HPO 4 12H 2 O,0.2 g KH 2 PO 4 , dilute to 1000 mL with ultrapure water for 30 min, and then dry at 37 °C to obtain a sample processing pad, which is vacuum-packed and stored at 4 °C for use.
[0078] 2) Colloidal gold-labeled two genetically engineered recombinant antigens, HIV and TP, were sprayed onto the glass cellulose membrane (300 mm×6 mm) at a volume of 50 μL per centimeter by the Bio-Dot film spotter to obtain gold-labeled conjugates Pad, after drying in a freeze dryer; paste it on the sample pad obtained in step 1);
[0079] 3) Immobilize HIV and TP two genetically engineered recombinant antigens and antibodies against HIV and TP two genetically engineered recombinant antigens on the p...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap