Botanic vegetative growth maintenance gene system and establishment of vegetative growth maintenance plant and method for utilizing infinite growth capacity of seed plants

A vegetative growth and gene system technology, applied in the fields of botanical equipment and methods, angiosperms/flowering plants, plant products, etc., can solve the problems of host cell death, expression, control mechanism is not completely clear, cytotoxicity and other issues

Inactive Publication Date: 2014-05-21
HENAN TIANMAO BIOLOGICAL
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Barnase is a classic and excellent endoribonuclease gene with particularly strong activity. As long as there is one copy in a cell, it can cause the host cell to commit suicide. However, the expression and control mechanism of this gene are not completely clear. When present in prokaryotic cells, it will produce cytotoxicity and lead to host cell death (see: Research on Cloning Strategy of Ribonuclease Barnase Gene, Song Hongyuan, Ding Jiangang, Song Ming Northwest Botanical Journal 2005 25 (6) )
This problem has been misleading and troubled some researchers for a long time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Botanic vegetative growth maintenance gene system and establishment of vegetative growth maintenance plant and method for utilizing infinite growth capacity of seed plants
  • Botanic vegetative growth maintenance gene system and establishment of vegetative growth maintenance plant and method for utilizing infinite growth capacity of seed plants
  • Botanic vegetative growth maintenance gene system and establishment of vegetative growth maintenance plant and method for utilizing infinite growth capacity of seed plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0098] Example 1 Construction of seed plant vegetative growth maintenance gene system (BTg-RBN)

[0099] (1) Cloning of Barstar gene:

[0100] Barstar gene was synthesized by PCR. The template is Bacillus amylobacter nuclear DNA, and the forward and reverse primers are: BTF1 5'- GTCCAATCTGCAGCCGTCCGAGACA -3', BTR1 5'- CGATTCAGGCGGCTG

[0101] ATATTCTCCA-3'.

[0102] The synthesized Barstar gene fragment was directly inserted into the pMD20-T vector of TaKaRa Company, confirmed by sequencing, and constructed into pMD20-BTg plasmid.

[0103] (2) Cloning of RBN promoter, coding sequence and terminator fragments:

[0104] The RBN gene is initially expressed in the Arabidopsis reproductive meristem AtREM1 Gene promoter, Barnase gene coding sequence, 3A terminator consists of 3 fragments. These three gene fragments are all cloned by PCR technology.

[0105] Gene promoter: The source of the fragment sequence is AL161579 (82727-83643bp), with a length of 919bp; the restriction si...

Embodiment 2

[0115] Embodiment 2 Construction of plant expression vector of seed plant vegetative growth maintenance gene system (BTg-RBN)

[0116] Only when the constructed vegetative growth-maintaining gene is loaded into a plant expression vector and transferred into a plant, can it present a function in the plant and play a role.

[0117] A variety of plant control expression vectors have been established so far, each with its own characteristics, such as pBI121, pCAMBIA series and so on. In this embodiment, the preferred expression vector is pCAMBIA3301. The vector carries the left and right borders LB and RB of the T-DNA of the Ti plasmid of Agrobacterium tumefaciens, and can be transformed into plants by the method mediated by Agrobacterium tumefaciens; the selectable marker in the plants is Bar.

[0118] The establishment of the vegetative growth maintenance gene system RBN.BTg expression vector was completed by cutting out the RBN-BTg fragment from the cloning vector with HindⅢ a...

Embodiment 3

[0119] Example 3 Identification of vegetative growth-maintaining plant bodies

[0120] Confirmed by detecting the presence of the (AtREM1-Barnase-3A) gene fragment, or related fragments, in the nuclear genome of transformed plants. The identification procedure is the same as that of general transgenic plants, and the upstream and downstream primers used can be respectively: RB t F: 5'-TTAGTAGGATTCTGGTGTGTGGG-3'; RB t R: 5'-TTCGATTTTTAATAGATTCGGTTTT-3'. The fragment length is 611bp (including AtREM1 Part of the promoter and Barnase coding sequence and part of the terminator sequence of 3A).

[0121] For plants whose reproductive organs appear after many years of planting, the identified transgenic plant materials can be directly grafted on adult trees (with a control) to finally determine whether reproductive organs, growth characteristics and other morphological characteristics can be produced. Generally, it takes 2 to 3 years to identify whether the transformed plant is ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a botanic vegetative growth maintenance gene system, the establishment of a vegetative growth maintenance plant, and a method for utilizing the infinite growth capacity of seed plants. The vegetative growth maintenance gene system comprises a promoter, a cellular lethal factor gene, and a gene device which is arranged when necessary and is used for limiting or eliminating the toxicity of non-target cells of the vegetative growth maintenance gene system; and the utilization of the infinite growth capacity of the seed plants is that the gene system is integrated into a botanic nuclear genome and accurately and correctly begins to perform expression according to given tissues and organs and the specificities of developmental stages. The vegetative growth maintenance gene system can effectively remove cells of reproductive meristems which appear in vegetative apical meristems, and prevent the vegetative meristems from being differentiated, so that a novel, high-yield and high-quality vegetative mass utilization plant, namely the vegetative growth maintenance plant is created; and the vegetative growth maintenance gene system can be applied to all vegetative mass utilization plants, so that the growth speed, production efficiency and yield of vegetative masses of the vegetative mass utilization plants are greatly improved on the original basis.

Description

technical field [0001] The invention relates to the fields of plant biotechnology, cell engineering, genetic engineering and modern agriculture, ecological construction, and environmental protection, and specifically relates to a plant vegetative growth-maintaining gene system, establishment of vegetative growth-maintaining plants, and methods for utilizing unlimited growth capacity of seed plants. Background technique [0002] (1) The role and status of vegetative utilization plants in modern agriculture [0003] Plants provide human beings with all food, most energy (firewood), clothing, housing, transportation, and other major and basic daily necessities, and are the material basis for human survival and development. [0004] Seed plants can be divided into rhizomes and leaves of vegetative organs and flowers, fruits and seeds of reproductive organs due to the different properties and functions of their organs. [0005] Plant vegetative organs and reproductive organs ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/11C12N15/82A01H5/00C12N5/10
Inventor陈占宽杨艳坤牛静勇秦天苍邓士政郝晓东韩书友陈净植刘文婷杜亚琼
OwnerHENAN TIANMAO BIOLOGICAL