Soybean zinc finger protein SCTF-1 and applications thereof
A technology of SCTF-1 and zinc finger protein, which is applied to soybean zinc finger protein gene SCTF-1 and its application field to achieve the effects of improving comprehensive stress tolerance and cold resistance of plants
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Soybean variety "Jinong 18" was selected. After the seedlings grew for a week, cultured at 4°C for 24 hours. The leaves were taken, ground with liquid nitrogen, and added to a 1.5ml EP tube containing lysate. After shaking and mixing, use the kit RNAiso Plus Extract total RNA, use formaldehyde denaturing gel electrophoresis to identify the quality of RNA, and then measure the concentration of RNA with a spectrophotometer; perform reverse transcription according to the instructions of the reverse transcription kit of FERMENTAS company in the United States to synthesize the first strand of cDNA; use plant C2H2 zinc The conserved sequence of the finger protein is a probe to search the soybean genome database. After alignment and sequence splicing, a soybean C2H2 zinc finger protein sequence with a full length of 802 bp is obtained. Based on this sequence, two primers are designed: CACAAGCATAAGCACAAGC, TGGATCTATGGATCAGTATTGAGG, using RT-PCR CDNA cloning was performed by the m...
Embodiment 2
[0029] According to the cDNA sequence of soybean C2H2 zinc finger protein gene SCTF-1, primers were designed to amplify the full coding reading frame, and Xba I restriction sites were added upstream and Sac I restriction sites were added downstream. Upstream primer: GGG TCTAGAATGGCTTTGGAAGCTCTTCA , Downstream primer: TTT GAGCTC GTATTGAGGGATTTCAATCTTGGGT, using the cDNA obtained in Example 1 as a template for PCR amplification, the SCTF-1 cDNA was cloned into the PMD-18T vector, and further down to the binary expression vector pBI121; The base sequence is shown in SEQ ID NO.2 in the sequence table, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2 in the sequence table. Link the GFP gene to the above vector to construct pBI121-SCTF- 1-GFP vector, pBI121-SCTF-1-GFP was transfected into onion epidermal cells by Agrobacterium infection for transient expression, and the pBI121-SCTF-1-GFP gene was found embedded in the onion epidermal cell through laser conf...
Embodiment 3
[0031] The expression vector pBI121-SCTF-1-GFP was transformed into Agrobacterium, and the method of Agrobacterium infection was further transformed into tobacco. After PCR, RT-PCR, and Southern hybridization were performed on the obtained transgenic plants, the T2 generation and control plants were subjected to stress tolerance analysis; cold-tolerant transgenic plants were obtained: the SCTF-1 gene-transformed tobacco and the control were placed in a 4°C incubator for continuous cultivation for 30 days, and then restored to 25°C for 12 hours at room temperature. Then, the transgenic tobacco and the control were placed under low temperature stress at -10°C for 30 minutes, and then restored to room temperature at 25°C for 12 hours.
[0032] The transgenic tobacco and the control were placed in a 4°C incubator for continuous cultivation for 30 days, and the growth was observed and recorded. It was found that after 24 hours of low temperature stress, the growth of the transgenic tob...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 
