Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Soybean zinc finger protein SCTF-1 and applications thereof

A technology of SCTF-1 and zinc finger protein, which is applied to soybean zinc finger protein gene SCTF-1 and its application field to achieve the effects of improving comprehensive stress tolerance and cold resistance of plants

Inactive Publication Date: 2011-09-14
JILIN AGRICULTURAL UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still relatively few studies on soybean zinc finger proteins at home and abroad, and only SCOF-1 has been analyzed clearly. The zinc finger protein encoded by it is a C protein with a typical double zinc finger structure. 2 h 2 Type zinc finger protein, which can significantly improve the low temperature tolerance of transgenic Arabidopsis (Kim et al., 2001)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Soybean zinc finger protein SCTF-1 and applications thereof
  • Soybean zinc finger protein SCTF-1 and applications thereof
  • Soybean zinc finger protein SCTF-1 and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Soybean variety "Jinong 18" was selected. After the seedlings grew for a week, cultured at 4°C for 24 hours. The leaves were taken, ground with liquid nitrogen, and added to a 1.5ml EP tube containing lysate. After shaking and mixing, use the kit RNAiso Plus Extract total RNA, use formaldehyde denaturing gel electrophoresis to identify the quality of RNA, and then measure the concentration of RNA with a spectrophotometer; perform reverse transcription according to the instructions of the reverse transcription kit of FERMENTAS company in the United States to synthesize the first strand of cDNA; use plant C2H2 zinc The conserved sequence of the finger protein is a probe to search the soybean genome database. After alignment and sequence splicing, a soybean C2H2 zinc finger protein sequence with a full length of 802 bp is obtained. Based on this sequence, two primers are designed: CACAAGCATAAGCACAAGC, TGGATCTATGGATCAGTATTGAGG, using RT-PCR CDNA cloning was performed by the m...

Embodiment 2

[0029] According to the cDNA sequence of soybean C2H2 zinc finger protein gene SCTF-1, primers were designed to amplify the full coding reading frame, and Xba I restriction sites were added upstream and Sac I restriction sites were added downstream. Upstream primer: GGG TCTAGAATGGCTTTGGAAGCTCTTCA , Downstream primer: TTT GAGCTC GTATTGAGGGATTTCAATCTTGGGT, using the cDNA obtained in Example 1 as a template for PCR amplification, the SCTF-1 cDNA was cloned into the PMD-18T vector, and further down to the binary expression vector pBI121; The base sequence is shown in SEQ ID NO.2 in the sequence table, and the amino acid sequence of the expressed protein is shown in SEQ ID NO.2 in the sequence table. Link the GFP gene to the above vector to construct pBI121-SCTF- 1-GFP vector, pBI121-SCTF-1-GFP was transfected into onion epidermal cells by Agrobacterium infection for transient expression, and the pBI121-SCTF-1-GFP gene was found embedded in the onion epidermal cell through laser conf...

Embodiment 3

[0031] The expression vector pBI121-SCTF-1-GFP was transformed into Agrobacterium, and the method of Agrobacterium infection was further transformed into tobacco. After PCR, RT-PCR, and Southern hybridization were performed on the obtained transgenic plants, the T2 generation and control plants were subjected to stress tolerance analysis; cold-tolerant transgenic plants were obtained: the SCTF-1 gene-transformed tobacco and the control were placed in a 4°C incubator for continuous cultivation for 30 days, and then restored to 25°C for 12 hours at room temperature. Then, the transgenic tobacco and the control were placed under low temperature stress at -10°C for 30 minutes, and then restored to room temperature at 25°C for 12 hours.

[0032] The transgenic tobacco and the control were placed in a 4°C incubator for continuous cultivation for 30 days, and the growth was observed and recorded. It was found that after 24 hours of low temperature stress, the growth of the transgenic tob...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a soybean zinc finger protein gene SCTF-1 which is a C2H2-type zinc finger protein gene which is discovered in soybean and is relevant with low temperature. The experiment shows that the protein coded by SCTF-1 can be located to a cell nucleus; after being excessively expressed, the gene can obviously improve cold resistance of transgenic plants, and has a function of improving plant comprehensive stress tolerance. The gene provided by the invention is derived from soybean, and comprises an excellent codon of dicotyledon, such as soybean and the like; and the gene engineering receptor of the gene is mainly suitable for dicotyledon, such as soybean, tobacco and cotton and the like, and also suitable for monocotyledon, such as rice, wheat and corn and the like.

Description

Technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to a transcription factor that responds to plant low temperature stress, specifically soybean zinc finger protein gene SCTF-1 and its application. technical background [0002] C2H2 type zinc finger protein is widely present in various plants, and related plant C at home and abroad 2 H 2 The research on type zinc finger protein has gradually increased, especially on plants such as Arabidopsis thaliana, Petunia hybrida Vilm and rice (Oryza sativa). Research has found a variety of plant C related to plant stress tolerance 2 H 2 Type zinc finger protein, for example, an STZ gene is found in Arabidopsis thaliana, which can encode a double zinc finger structure of C 2 H 2 Type zinc finger protein, STZ gene-transformed tobacco significantly improves the tolerance to cold and high salt conditions (Sakamoto et al., 2000); the zinc finger protein gene ZPT2-3 obtained from petunia, its...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12N15/10C12N15/82C07K14/415A01H5/00
Inventor 王丕武宋冰洪洋王贺付永平张卓李勃王鹏马建杜鹃王丹
Owner JILIN AGRICULTURAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com