Method for enhancing aphid resistance of plant

An anti-aphid, plant technology, applied in the fields of botanical equipment and methods, plant products, angiosperms/flowering plants, etc., can solve problems such as easy environmental pollution by pesticides, and achieve the effect of enhancing resistance

Active Publication Date: 2011-10-05
SHANGHAI JIAO TONG UNIV
View PDF3 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Pesticides play an important role in resisting pests, however, pests are gradually developing resistance to pesticides, in addition, pesticides are also easy to pollute the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for enhancing aphid resistance of plant
  • Method for enhancing aphid resistance of plant
  • Method for enhancing aphid resistance of plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 is used to construct dsDDB1, the isolation of dsCYP6 gene

[0038] Extract RNA from the second-instar aphids, and reverse it into single-stranded eDNA, use the cDNA single-stranded as a template, and use the following specific primers for PCR:

[0039] Primer pairs used to obtain DDB1 gene fragments:

[0040] DDB1F: CACCCCTGAAGACCAAGATCCCAAATT

[0041] DDB1R: ATCTCATCAAATCACCGCAAACA

[0042] Primer pairs for obtaining CYP6-1 gene fragments:

[0043] CYP6-1F: CACC AAGTACCCCATAGCTTATAGCATAA

[0044] CYP6-1R: CATTTGGTCTTTGAGATTTCTGTTC

[0045] After PCR amplification with KOD enzyme, the specific fragments are recovered.

Embodiment 2

[0046] Construction and transformation of embodiment 2 expression vector

[0047] 1. Construction of 35S::dsDDB1, 35S::dsCYP6 expression vector

[0048] The inventor cloned the specific fragment into the ENTR vector through the pENTR-D-TOPO cloning kit to form two ENTR intermediate vectors, pENTR-D / SD-TOPO-DDB1 and pENTR-D / SD-TOPO-CYP6-1, and then Through the LR reaction, the two gene fragments of DDB1 and CYP6-1 were respectively substituted for the ccdB lethal gene sequence on the pANDA vector to construct a construct as described in Formula 1. The spacer sequence is a GUS sequence. The constructed vectors are called 35S::dsDDB1 and 35S::dsCYP6-1 expression vectors respectively. Its construction process is attached figure 2 shown.

[0049] 2. Transformation of Agrobacterium tumefaciens

[0050] The transformation of Agrobacterium tumefaciens was performed by freeze-thaw method. A single colony of GV3101 (purchased from Invitrogen) was cultured overnight in 3 mL of LB ...

Embodiment 3

[0051] Example 3 Plant Transformation and Screening of Transgenic Progeny

[0052] In this example, the transgene of Arabidopsis is taken as an example.

[0053] Transformation of Arabidopsis plants was performed using the floral dip method. A single colony GV3101 containing a binary vector, 3 mL of LB medium (containing 25 μg / mL rifampicin, 50 μg / mL gentamicin and 50 μg / ml kanamycin), 28° C., 220 rpm, 24 hours. 3ml bacterial solution, 300ml LB medium (containing 25ug / ml rifampicin, 50ug / ml gentamycin and 50ug / ml kanamycin), 28°C, 220rpm, 16-20 hours. 5000rpm 10min. The bacteria were resuspended in 300ml of 5% sucrose solution containing 0.02% Silwet L-77. The flower bud part of the plant is soaked in the bacterial solution for 10 seconds, covered with plastic wrap, placed flat in a plastic basin, kept moist and protected from light, for 24 hours, then stood upright, and grown in the greenhouse until flowering and seeding. The T0 generation seeds were vernalized for 3 days...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for enhancing the aphid resistance of a plant, belonging to the technical field of biology. With the method, a construct expressing the dsRNA (Double-Stranded RNA) of an aphid gene is transferred into the plant; the construct expressing the dsRNA of the aphid gene is double-stranded, a positive-sense strand and a negative-sense strand of the aphid gene contain the following structures: Ap forward direction-X-Ap reverse direction, wherein the Ap forward direction is a forward sequence or fragment of the aphid gene, the Ap reverse direction is a reverse complementary sequence or fragment of the same aphid gene, and X is an intervening sequence positioned between the Ap forward direction and the Ap reverse direction; and the dsRNA shown in the description is formed after a constructed vector is transcribed in the plant, wherein ll expresses a hydrogen bond formed between the Ap forward direction and the Ap reverse direction.

Description

technical field [0001] The invention relates to a method for enhancing plant resistance to insect pests in the field of biotechnology. In particular, it relates to a method of enhancing the resistance of plants to aphids. Background technique [0002] Pests have always been one of the key factors affecting crop yields. Pesticides play an important role in resisting pests, but pests are gradually developing resistance to pesticides. In addition, pesticides are easy to pollute the environment. Genetic modification has made a major contribution to helping crops resist pests with chewing mouthparts. For example, cotton transformed with Bt toxin protein has high resistance to cotton bollworm. The growth of cotton bollworm can also be inhibited by RNAi interference transgenic technology. However, for pests with piercing-sucking mouthparts, such as aphids, there is an urgent need to find new ways to effectively help plants resist such pests. Contents of the invention [0003...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/63C12N15/113A01H5/00
Inventor 唐克轩张飞
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap