Method for preparing recombinant porcine alpha-interferon

A technology of interferon and gene, applied in the field of preparation of recombinant porcine α-interferon, can solve the problems of difficult popularization and application, cumbersome operation, low yield, etc., and achieve the effect of improving antiviral activity

Active Publication Date: 2011-11-02
HUNAN AGRI UNIV ANIMAL PHARMA
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the traditional extraction method of interferon has low yield and cumbersome operation, and it is difficult to popularize and apply. Therefore, finding a method for efficiently producing interferon has become an urgent problem to be solved.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing recombinant porcine alpha-interferon
  • Method for preparing recombinant porcine alpha-interferon
  • Method for preparing recombinant porcine alpha-interferon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0018] Embodiment 1 Construction of Pichia pastoris recombinant expression vector

[0019] 1) Design and synthesis of primers

[0020] Using DNAstar gene analysis software, refer to the mature peptide nucleotide sequence of porcine α-interferon gene (AY331298) on NCBI genbank, artificially synthesize the gene sequence and use the software to design specific primers for amplifying porcine α-interferon gene. The end is the connection site of the yeast expression vector PHBM905a (underlined part). Primer sequences (5'-3') are as follows:

[0021] 1: GTCA ATGTGTGATTTGCCACAAACCCATTCACTTGCTCACACTAGAGC

[0022] 2: ATTCTTCTCATCTGAGCCAACAGTCTCAAAGCTCTAGTGTGAGCAAGT

[0023] 3: TTGGCTCAGATGAGAAGAATTTCTCCATTTTCTTGTTTGGATCATAGA

[0024] 4: CTTCATGTGGAGAACCGAAATCTCTTCTATGATCCAAAACAAGAAAATG

[0025] 5: TCGGTTCTCCACATGAAGCTTTGGGTGGCAACCAAGTTCAAAAGGCCC

[0026] 6: GCAACATTTCGTGAACCAAAGCCATAGCTTGGGCCTTTTGAACTTGGT

[0027] 7: TTGGTTCACGAAATGTTGCAGCAAACTTTCCAATTGTTTTCTACTGAA

[0028] 8: ...

Embodiment 2

[0053] Example 2 High-density induced expression of exogenous genes in Pichia pastoris

[0054] 1) Pick a single colony of recombinant Pichia pastoris to be expressed in BMGY liquid medium (bottling at ≤10%) at 28° C., 280 rpm. Cultivate on a shaker until logarithmic phase (OD600=2).

[0055] 2) Transfer 1 mL of the culture solution to 100 mL of BMGY liquid medium (bottling at ≤10%), culture at 28° C. on a shaker at 280 rpm until mid-logarithmic phase (OD600=20).

[0056] 3) Centrifuge at room temperature at 4,000rpm for 5min, collect the bacteria, remove the supernatant, transfer all the cell pellets to 100mL BMMY liquid medium, and culture on a shaker at 28°C at 280rpm.

[0057] 4) Add 100% methanol every 24 hours to a final concentration of 0.5%.

[0058] 5) From the time when the cell pellet was transferred to the BMMY liquid medium for induction, 1 mL was sampled every 24 hours to analyze the expression level, and the optimal induction time was determined to be 84 hours...

Embodiment 3

[0060] Example 3 High-density induced expression of exogenous genes in Pichia pastoris

[0061] 1) Pick a single colony of recombinant Pichia pastoris to be expressed in BMGY liquid medium (bottling at ≤10%), 30° C., 300 rpm. Cultivate on a shaker until logarithmic phase (OD600=6).

[0062] 2) Transfer 1 mL of the culture solution to 100 mL of BMGY liquid medium (bottled at ≤10%), and culture it on a shaker at 28-30° C. at 300 rpm until mid-logarithmic phase (OD600=30).

[0063] 3) Centrifuge at room temperature at 4,000rpm for 5min, collect the bacteria, remove the supernatant, transfer all the cell pellets to 100mL BMMY liquid medium, and culture on a shaker at 28°C at 300rpm.

[0064] 4) Add 100% methanol every 24 hours to a final concentration of 0.5%.

[0065] 5) From the time when the cell pellet was transferred to the BMMY liquid medium for induction, 1 mL was sampled every 24 hours to analyze the expression level, and the optimal induction time was determined to be 7...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to view more

Abstract

The invention provides a method for preparing porcine alpha-interferon, which comprises: obtaining the coding region of a porcine alpha-interferon gene by the conventional polymerase chain reaction (PCR) process; cloning the coding region to a Pichia pastoris secretory expression vector pHBM905A; performing electric transformation of Pichia pastoris; and screening a high-resistance transformant to realize the secretory expression of the recombinant protein in the Pichia pastoris and obtaining the recombinant protein with antiviral activity. In the invention, by optimizing the expression system of the Pichia pastoris, the antiviral activity of the recombinant protein is improved.

Description

technical field [0001] The invention belongs to the utilization of genetic engineering, and in particular relates to a preparation method of recombinant porcine α-interferon. Background technique [0002] Interferon is the earliest and fastest-acting first virus defense system known in animals. Human and mouse interferons have been extensively studied, but relatively little has been done on porcine interferons. [0003] Porcine α-interferon is a protein family encoded by more than 10 related functional genes, and there is a high degree of homology between porcine α-interferon subtypes and porcine ω-interferon subtypes. Natural porcine α-interferon is often a mixture of functional gene expression products of porcine α- and ω-interferon. The mature porcine α-interferon consists of 166 amino acids, and the signal peptide that induces its secretion and expression consists of 23 amino acids. Pig interferon-alpha has no intron, and has the highest homology with human interferon...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/81C12R1/84
Inventor 刘美赵宝凯廖峰马立新余晓岚
Owner HUNAN AGRI UNIV ANIMAL PHARMA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap