Method for preparing ethanol by fermenting jerusalem artichoke through recombinant saccharomyces cerevisiae

A technology of recombinant Saccharomyces cerevisiae and Jerusalem artichoke, which is applied in the construction of recombinant Saccharomyces cerevisiae, fermented ethanol, and the field of recombinant Saccharomyces cerevisiae fermented ethanol, which can solve the problems of long fermentation time and poor ethanol tolerance, and achieve high sugar alcohol conversion rate and low residual sugar , The effect of fast ethanol fermentation rate

Active Publication Date: 2013-11-06
DALIAN UNIV OF TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The purpose of the present invention is to provide a method for producing fuel ethanol by fermenting Jerusalem artichoke dry powder obtained by recombinant Saccharomyces cerevisiae obtained in the present invention, so as to solve the problems of long fermentation time and poor ethanol tolerance existing in existing strains

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing ethanol by fermenting jerusalem artichoke through recombinant saccharomyces cerevisiae
  • Method for preparing ethanol by fermenting jerusalem artichoke through recombinant saccharomyces cerevisiae
  • Method for preparing ethanol by fermenting jerusalem artichoke through recombinant saccharomyces cerevisiae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of Inulinase Integrated Expression Vector

[0031] According to the sequence of inulinase (GenBank: X57202), design primers p-inu forward primer: GCCggatccGAATTCTCAAACCGAA (BamH I) and p-inu reverse primer: CGG gcgcgc AGATCAGATCAAACG (BssH II), using K. marxianus Kluyveromyces marxianus (CGMCC2.1549) genome as a template to amplify the p-inu gene. PCR system: 1 μl template, 1 μl each F / R primer, 1 μl enzyme, 4 μl dNTP, 5 μl buffer, ddH 2 O 37μl; PCR program: 94°C pre-denaturation for 5min; 94°C for 1min, 63.6°C for 1min, 72°C for 3min, 30 cycles; 72°C for 10min. After the PCR product was recovered and purified by gel, it was connected with the vector pMD19-T. The positive clones were sequenced after extracting the plasmids, and the results of sequencing analysis proved that the inulinase gene was consistent with the inulinase gene reported by NCBI. pMD19T / p-inu digested with BamH I and BssH II and HO-2 (HO-poly-KanMX 4 -HO, Warren P V, James ...

Embodiment 2

[0032] Example 2 Transformation of S. cerevisiae Saccharomyces cerevisiae (CGMCC2.1882) and verification of transformants .cerevisiae Saccharomyces cerevisiae (CGMCC2.1882) competent cells on YPD (anhydrous glucose 20, yeast extract powder 10, peptone 20 and 1.5% agar powder) plates containing 300 μg / mL G418. Transform by electric shock method, you can refer to BIORAD MicroPulser TMElectric Rotator Instruction Manual. Cultivate at 30°C for 2-3 days, select transformants, and extract the genomic DNA of HI6 / 6. It was verified by PCR method. The primer sequences used for the verification of HI6 / 6 are HI6 / 6 forward primer: AGCTTAATTATCCTGGGCACGAGT and HI6 / 6 reverse primer: GCGAGCTCAGCTCGTTTTCGACACTGGA. PCR program: 94°C pre-denaturation for 5 minutes; 94°C for 1 minute, 60°C for 1 minute, 72°C for 3 minutes, 30 cycles; 72°C for 10 minutes. 1% agarose electrophoresis showed that a fragment of the correct size was obtained, which proved that a positive transformant was obtained....

Embodiment 3

[0033] Example 3 Investigation of Transformant Enzyme Production

[0034] Take 100 μL of each of S.cerevisiae 6525 and transformant HI6 / 6, inoculate into 50 mL of YPD medium, culture at 30°C for 24 hours, inoculate 10% into seed medium, 100 / 250 mL shake flask, culture at 30°C and take samples every 24 hours . After the fermentation broth was properly diluted, the cell density (OD 600 ); after the fermentation broth was centrifuged at 5000rp for 10 min, the supernatant was used to measure inulinase activity. The biomass of transformant HI6 / 6 was almost the same as that of the starting strain, reaching 9g / L; the inulinase activity of transformant HI6 / 6 reached the highest enzyme activity of 86U / mL at 144h, which was 4.5 times that of the starting strain.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of biotechnology and discloses a method for preparing ethanol by fermenting jerusalem artichoke through recombinant saccharomyces cerevisiae. The method provided by the invention comprises the following steps of: taking the jerusalem artichoke powder as a culture medium and carrying out anaerobic fermentation by utilizing the recombinant saccharomyces cerevisiae to prepare the ethanol, wherein the fermentation concentration of the ethanol can be more than 9% in 60 hours. By utilizing the raw material and the fermenting method provided by the invention, corn meal, wheat meal and the like which are grain raw materials and are used in the traditional ethanol industrial production in China can be replaced and a foundation is laid for the non-grain-fuel ethanol production.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a construction method of recombinant Saccharomyces cerevisiae, specifically a construction method of recombinant Saccharomyces cerevisiae for fermenting Jerusalem artichoke to produce ethanol; the present invention also relates to a method for fermenting ethanol, specifically, using recombinant Saccharomyces cerevisiae to ferment ethanol Methods. Background technique [0002] Resources, energy and the environment are major bottlenecks restricting the sustainable development of the national economy and society. Actively exploring and creating new technologies and establishing an environment-friendly society with sustainable use of resources and energy are important contents of scientific and technological innovation during the "Twelfth Five-Year Plan" period one. The main way to achieve this goal is to use non-cultivated land to grow high-yield energy plants on a large scale and develo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12P7/06C12N15/81C12R1/865
CPCY02E50/10
Inventor袁文杰李楠楠任剑刚辛程勋白凤武
OwnerDALIAN UNIV OF TECH