Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof

A growth hormone receptor and fish technology, which is applied in the direction of hormone receptors, biochemical equipment and methods, botany equipment and methods, etc., can solve problems such as inconsistent effects, and achieve high activity of signaling pathways, transgene-promoting Prominent growth effect

Inactive Publication Date: 2011-11-16
INST OF AQUATIC LIFE ACAD SINICA
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the negative feedback effect of the GH signaling pathway and the diverse genetic backgrounds of the tested fish, the growth-promoting effect caused by exogenous GH gene transfer is not consistent in different fish (Devlin, R.H., C.A.Biagi, et al. (2001).″Growth of domesticated transgenic fish.″Nature 409(6822): 781-782 Devlin, R.H., D. Sakhrani, et al. (2009).″Domestication and growth hormone transgenesis cause similar changes in gene expression in coho salmon(Oncorhynchus kisutch). "Proc Natl Acad Sci U S A 106(9):3047-3052.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof
  • Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof
  • Continuously activated growth hormone receptor gene of fishes, and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Molecular Design of Recombinant Proteins for Sustained Activation of Recombinant Growth Hormone Receptor

[0059] Through protein structure prediction ( http: / / swissmodel.expasy.org / / SWISS-MODEL.html ) SWISS-MODEL program and protein structure analysis ( http: / / swissmodel.expasy.org / spdbv / )Swiss-PdbViewer program, based on our previous deep understanding of the GHR signaling pathway, molecularly designed a continuously activated recombinant growth hormone receptor molecule:

[0060] 1) Carp GHR signal peptide:

[0061] MAYSLSLGLLYLGLLCGNGLVSARSE

[0062] 2) Carp c-Jun leucine zipper region:

[0063] RIKAERKRLRNRLAATKCRKRKLERISRLEEKVKVLKNDNAGLSNTASVLRDQVAQLKQKV

[0064] 4) Carp GHR transmembrane region and intracellular region:

[0065] LRVAQIPSKESTFPTTLVLIFGVIGVVILLVLLIFSQQQRLMVIFLPPIPAPKIKGIDPELLKNGKLDQLNSLLSSQDMYKPDFYHEDPWVEFIQLDLDDPAEKNESSDTQHLLGLSRSGSSHFLNFKSDNDSGRASCYDPEIPNPKDLASFLPGHSGRGDNHPLVSRSSSSIPDLGFQQTSEVEETPIQTQPAVPSWVNMDFYAQVSDFTPAGGVVLSPGQLNSSPVKK...

Embodiment 2

[0068] Preparation of continuously activated GHR recombinant gene

[0069] 1) Primer design.

[0070] Primers for amplifying the GHR signal peptide:

[0071] F: CAGATCGATCACCCGGGAGCCACCATGGCTTACTCTCTCTCGCTC

[0072] R: TTTCCGCCTTGATGCGCTCGGATCTTGCAGACACCAG

[0073] Primers for amplifying the c-Jun zipper region:

[0074] F: CAAGATCCGAGCGCATCAAGGCGGAAAGGAAGAG

[0075] R: CTTGGTATCTGTGCCACTTCTCAGGACTTTCTGTTTGAGTTG

[0076] Primers for amplifying the GHR signaling region:

[0077] F: CCTGAGAGTGGCACAGATACCAAAGCAAAG

[0078] R: GTTCTCGAGATTCATGGGTTCAGGTTTCCCCAGAAG

[0079] 2) The GHR signal peptide, the c-Jun leucine zipper region, the GHR transmembrane region and the intracellular region were respectively amplified by PCR.

[0080] GHR signal peptide amplification conditions were: 95°C pre-denaturation for 4 minutes; 95°C for 30 seconds, 66°C for 30 seconds, 68°C for 30 seconds, 13 cycles; 68°C for 10 minutes; 4°C storage.

[0081] The c-Jun leucine zipper region amplificat...

Embodiment 3

[0088] A persistently activated growth hormone receptor gene in zebrafish.

[0089] 1) Preparation of transgenic zebrafish:

[0090] Taking zebrafish as the object, the zebrafish transfected with GHR gene was prepared continuously. After the expression vector pCA-SJG-AT was extracted by the plasmid miniprep kit (Axygen Company), the plasmid DNA was dissolved in ST solution (88mmol / l NaCl, 10mmol / l Tris-HCl, pH 7.5), and the final concentration was adjusted 85ng / μl, using the method of microinjection (Zhu Z, Li G, He L, et al. Novel gene transfer into the fertilized eggs of goldfish (Carassius auratus L.1758). Zangew Ichthyol, 1985, 1:31 -34), before the first cleavage, the DNA solution is introduced into the animal pole of the zebrafish fertilized eggs, the DNA injection dose is 1-2nl / egg, and the fertilized eggs after the micromanipulation is completed are incubated and cultured at a water temperature of 28.5°C.

[0091] 2) Screening of fast-growing fish transfected with pe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a continuously activated growth hormone receptor gene of fishes, and a preparation method and application thereof. The preparation method comprises the following steps of: respectively performing polymerase chain reaction (PCR) amplification on growth hormone receptor (GHR) signal peptide, a c-Jun leucine zipper region, a GHR transmembrane region and an intracellular region of carp, and combining another turn of bridge-PCR amplification to obtain a continuously activated GHR recombinant gene segment; and cloning the obtained recombinant gene into an expression vector pCA-AT to obtain a recombinant gene vector pCA-SJG-AT for gene transfer. A protein encoded by the gene has the amino acid sequence shown as SEQIDNO:1; and a separated recombinant gene has the nucleotide sequence shown as SEQIDNO:2. The application of the recombinant gene in quick growth of transgenic fish has the advantages that: (1) the activity of the recombinant GHR protein for promoting a signal channel is high, and the efficiency of the continuously activated GHR effect is more than 3 times higher than that of GH effect; and (2) the transgene of the continuously activated GHR gene has obvious growth promotion effect, and the transgenic fish has a growth speed which is over 50 percent higher than that of contrast fish.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering breeding of aquatic economic animals. The invention relates to a recombinant gene for continuously activating fish growth hormone signaling pathway and promoting fish growth, a preparation method of the recombinant gene, and a recombinant gene Application in fish genetic engineering breeding. Background technique [0002] Growth rate is one of the most economically important traits in aquaculture animals. In the case of limited and increasingly scarce natural fishing resources, how to increase the growth rate and yield of farmed fish has become an urgent issue at present. At the same time, increasing the growth rate of farmed fish can speed up the market cycle of commercial fish and provide new breeds of higher-quality farmed fish, thereby improving economic benefits. Therefore, it has important practical application value (Chen, T.T., N.H.Vrolijk, et al. (1996). "Transgenic fish and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/72C12N15/12C12N15/10C12N15/63A01K67/033
Inventor 孙永华朱作言熊凤伊斯提亚克迈克沃特斯
Owner INST OF AQUATIC LIFE ACAD SINICA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com