Enterohemorrhagic Escherichia coli stx2 gene detection kit and its application method
A technology for Escherichia coli and gene detection, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of long detection cycle, easy cross-contamination operation process, and many reagents
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0084] The preparation of embodiment 1 kit
[0085] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0086] Outer primer F3(1): (SEQ ID NO 1)
[0087] CTTCGTTAAATAGTATACGGACA
[0088] Outer primer B3 (1): (SEQ ID NO 2)
[0089] GGCCACATATAAATTATTTTGCT
[0090] Internal primer FIP (1): (SEQ ID NO 3)
[0091] GTGTGGTTAATAACAGACACCGATGTTTTGAGATATCGACCCCTCTTG
[0092] Internal primer BIP (1): (SEQ ID NO 4)
[0093] GGCAGTTATTTTGCTGTGGATATACTTTTTATAATCAGACGAAGATGGTCAA.
[0094] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;
[0095] (3) Prepare reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 1.2 μmol / L of inner primer FIP / BIP and each 0.2 μmol / L of outer primer F3 / B3 are placed in the container;
[0096] (4) Prepare the sample p...
Embodiment 2
[0107] The preparation of embodiment 2 kit
[0108] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0109] Outer primer F3 (2): (SEQ ID NO 5)
[0110] TGCAAATCAGTCGTCACT
[0111] Outer primer B3 (2): (SEQ ID NO 6)
[0112] CATCGTATACACAGGAGCA
[0113] Internal primer FIP (2): (SEQ ID NO 7)
[0114] TCTGGATGCATCTCTGGTCATTTTTCACTGGTTTCATCATATCTGG
[0115] Internal primer BIP (2): (SEQ ID NO 8)
[0116] AGTTCTGCGTTTTGTCACTGTTTTTTGCCTGACGAAATTCTCTC.
[0117] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;
[0118] (3) Prepare reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1 volume % TritonX-100, 0.8mol / L betaine, each 2.0 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, put in the container;
[0119] (4) Prepare the sample pretreatment solution: the sa...
Embodiment 3
[0125] Example 3 Application of Enterohemorrhagic Escherichia coli stx2 Gene Detection Kit
[0126] 1 Materials and methods
[0127] 1.1 Materials
[0128] 1.1.1 Strains
[0129] There are 25 bacterial strains used in the present invention, mainly from Guangzhou Entry-Exit Inspection and Quarantine Bureau, clinical isolated bacterial strains and environmental isolated bacterial strains. See Table 1 for details.
[0130] Table 1 Names and sources of strains
[0131] strain source Strain and serial number Guangzhou CIQ Enterohemorrhagic Escherichia coli Clinical isolates 17 strains of enterohaemorrhagic Escherichia coli from the test samples; other strains 1 strain each of Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Salmonella, Listeria monocytogenes, Yersinia enterocolitica, and beta-hemolytic streptococcus.
[0132] 1.1.2 Main instruments and reagents
[0133] 1.2 Identification of isolated strains
[0134] 1.2.1 Culti...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com