Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Enterohemorrhagic Escherichia coli stx2 gene detection kit and its application method

A technology for Escherichia coli and gene detection, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of long detection cycle, easy cross-contamination operation process, and many reagents

Inactive Publication Date: 2011-12-21
GUANGZHOU HUAFENG BIOTECH +1
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006]The traditional detection method of enterohemorrhagic Escherichia coli is far from meeting the requirements of modern detection due to its shortcomings such as long detection cycle, complicated procedures, and various reagents required
The pathogenic nucleic acid detection technology represented by polymerase chain reaction (PCR) technology has some problems in practical application, such as ordinary polymerase chain reaction (PCR) technology requires special instruments, and there are easy cross-contamination and cumbersome operation process Shortcomings
Although the fluorescent real-time quantitative polymerase chain reaction (real time PCR) technology has better solved the problem of cross-contamination and simplified the operation process, it requires more complex quantitative measurement instruments, so it is not suitable for on-site rapid detection
Moreover, the cost of fluorescent probes in real-time quantitative polymerase chain reaction PCR technology is relatively high, which increases the difficulty of popularization and application.
Immunological detection technology is fast, simple and low-cost, but requires high-quality and high-stability monoclonal antibodies. Otherwise, due to insufficient accuracy, it can only be used as an auxiliary detection method at present.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Enterohemorrhagic Escherichia coli stx2 gene detection kit and its application method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0084] The preparation of embodiment 1 kit

[0085] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0086] Outer primer F3(1): (SEQ ID NO 1)

[0087] CTTCGTTAAATAGTATACGGACA

[0088] Outer primer B3 (1): (SEQ ID NO 2)

[0089] GGCCACATATAAATTATTTTGCT

[0090] Internal primer FIP (1): (SEQ ID NO 3)

[0091] GTGTGGTTAATAACAGACACCGATGTTTTGAGATATCGACCCCTCTTG

[0092] Internal primer BIP (1): (SEQ ID NO 4)

[0093] GGCAGTTATTTTGCTGTGGATATACTTTTTATAATCAGACGAAGATGGTCAA.

[0094] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;

[0095] (3) Prepare reaction solution and primers: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L KCl, 12.5mmol / L (NH 4 ) 2 SO 4 , 10mmol / L MgSO 4 , 0.125% by volume TritonX-100, 1mol / L betaine, each 1.2 μmol / L of inner primer FIP / BIP and each 0.2 μmol / L of outer primer F3 / B3 are placed in the container;

[0096] (4) Prepare the sample p...

Embodiment 2

[0107] The preparation of embodiment 2 kit

[0108] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0109] Outer primer F3 (2): (SEQ ID NO 5)

[0110] TGCAAATCAGTCGTCACT

[0111] Outer primer B3 (2): (SEQ ID NO 6)

[0112] CATCGTATACACAGGAGCA

[0113] Internal primer FIP (2): (SEQ ID NO 7)

[0114] TCTGGATGCATCTCTGGTCATTTTTCACTGGTTTCATCATATCTGG

[0115] Internal primer BIP (2): (SEQ ID NO 8)

[0116] AGTTCTGCGTTTTGTCACTGTTTTTTGCCTGACGAAATTCTCTC.

[0117] (2) Purchasing DNA polymerase: Bst DNA polymerase is placed in the container;

[0118] (3) Prepare reaction solution and primers: the reaction solution contains 1.6mmol / LdNTP, 20mmol / L Tris-Cl, 10mmol / L KCl, 10mmol / L (NH 4 ) 2 SO 4 , 8mmol / L MgSO 4 , 0.1 volume % TritonX-100, 0.8mol / L betaine, each 2.0 μmol / L of inner primer FIP / BIP and each 0.25 μmol / L of outer primer F3 / B3, put in the container;

[0119] (4) Prepare the sample pretreatment solution: the sa...

Embodiment 3

[0125] Example 3 Application of Enterohemorrhagic Escherichia coli stx2 Gene Detection Kit

[0126] 1 Materials and methods

[0127] 1.1 Materials

[0128] 1.1.1 Strains

[0129] There are 25 bacterial strains used in the present invention, mainly from Guangzhou Entry-Exit Inspection and Quarantine Bureau, clinical isolated bacterial strains and environmental isolated bacterial strains. See Table 1 for details.

[0130] Table 1 Names and sources of strains

[0131] strain source Strain and serial number Guangzhou CIQ Enterohemorrhagic Escherichia coli Clinical isolates 17 strains of enterohaemorrhagic Escherichia coli from the test samples; other strains 1 strain each of Staphylococcus aureus, Shigella, Vibrio parahaemolyticus, Salmonella, Listeria monocytogenes, Yersinia enterocolitica, and beta-hemolytic streptococcus.

[0132] 1.1.2 Main instruments and reagents

[0133] 1.2 Identification of isolated strains

[0134] 1.2.1 Culti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a detection kit for E.coli stx2 gene. The E.coli stx2 gene detection kit includes two pairs of primers designed based on the loop-mediated constant temperature amplification technology with the stx2 gene as the target gene. : inner primer FIP / BIP and outer primer F3 / B3. The enterohaemorrhagic Escherichia coli stx2 gene detection kit of the present invention has more comprehensive detection effect and low missed detection rate.

Description

technical field [0001] The invention relates to biological detection reagents, in particular to an enterohaemorrhagic Escherichia coli stx2 gene detection kit and a use method thereof. Background technique [0002] Enterohemorrhagic Escherichia coli (EHEC) infection broke out in Germany in May 2011. According to the report of the World Health Organization, as of June 5, Germany had reported 630 HUS cases and 15 deaths; 1601 EHEC infection cases and 6 deaths example. In addition, 12 European countries including Austria, Czech Republic, Sweden, Denmark, Netherlands, Poland, France, Switzerland, Norway, Spain, Luxembourg and the United Kingdom reported a total of 31 cases of HUS (1 death) and 73 cases of EHEC infection. Two cases of HUS were reported in the United States. [0003] Enterohaemorrhagic E. coli infection is a zoonotic disease that primarily causes abdominal cramping and mild diarrhea, some cases bloody (hemorrhagic enteritis). Most patients recover within 10 day...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/10
Inventor 陆晔田桢干王传现章琪卢钟山曹以诚杜正平陈洵谭慧媚
Owner GUANGZHOU HUAFENG BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products