Unlock instant, AI-driven research and patent intelligence for your innovation.

A rice heavy metal-inducible tissue-specific promoter mtp11p and its application

A tissue-specific, heavy metal technology, applied in the field of plant genetic engineering, can solve problems such as the threat of rice production safety and heavy metal pollution

Inactive Publication Date: 2011-12-28
SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Rice is one of the most important food crops in the world, but with the development of industry and mining, rice planting areas are seriously polluted by heavy metals, which threatens the safety of rice production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A rice heavy metal-inducible tissue-specific promoter mtp11p and its application
  • A rice heavy metal-inducible tissue-specific promoter mtp11p and its application
  • A rice heavy metal-inducible tissue-specific promoter mtp11p and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning of the OsMTP11 gene

[0034] Take the leaves of rice Nipponbare seedlings, use TriZol Reagent (Invitrogen Company, its article number: 15596026) to extract the total RNA of the leaves, use agarose gel electrophoresis and ultraviolet spectrophotometer to detect the purity and amount of total RNA, and take 1 μg of total RNA For the initial reverse transcription reaction, the reverse transcriptase used is M-MLV (promega company, its product number: M1701), and the steps of the reverse transcription reaction refer to the instructions for use of the reverse transcriptase. Using the reverse transcription product as a template, design specific primers for the OsMTP11 gene:

[0035] M11F1 (5'TGACCGAGGGAGACTGCCCACC3')

[0036] M11R1 (5'CTGCTAAACTTAATACCAGTGG3'),

[0037] Use high-fidelity Taq enzyme for PCR. The PCR reaction system is: reverse transcription product 1 μl, 10xBuffer 5 μl, dNTP (each 2.5mM) 4 μl, M11F1 (10 μM) 1 μl, M11R1 (10 μM) 1 μl, Taq enzy...

Embodiment 2

[0038] Example 2: Genetic Transformation of Saccharomyces cerevisiae

[0039] Using the pGEM T recombinant plasmid containing the OsMTP11 gene cDNA in Example 1 as a template, design primer F1 (5'TTTCAGGGCG CCATGG ATGCGGCGGCGGTCGCGGG3') (the underline indicates the NcoI restriction site) and R1 (5'TCATGCTAGA CCATGG CTATTTTTCATGGGACAGAG3') (the underline indicates the NcoI restriction site). The reaction system is: pGEM T recombinant plasmid containing OsMTP11 gene cDNA (50ng / μl) 1μl, 10xBuffer 5μl, dNTP (each 2.5mM) 4μl, F1 (10μM) 1μl, R1 (10μM) 1μl, Taq enzyme (5U / μl) 1 μl, ddH 2O 37 μl. Mix well after adding the sample on ice. The reaction conditions are: 94°C for 5 min; 30 cycles of 94°C for 30 sec, 55°C for 30 sec, and 72°C for 80 sec; 72°C for 10 min. After the PCR reaction, a 1.25kb DNA fragment was obtained. The fragment was purified, and the In-fusion Advantage PCR Cloning Kit (Clontech, its catalog number: 639616) was used to insert it forward into the NcoI en...

Embodiment 3

[0047] Embodiment 3: Determination of yeast ion content

[0048] The formula of the yeast culture medium used is as follows:

[0049] Limit medium YNB (per 1L): yeast nitrogen source 1.7g, ammonium sulfate 5g, galactose 20g, dissolve to 1L, aliquot into 100mL, 115°C, 15min. The amount of agar powder added to the solid medium was 2% (g / mL).

[0050] Amino acid: L-His (240mg / 100mL): weigh 0.12g dissolved in 50mL sterilized ddH2O, filter sterilize

[0051] L-Leu (720mg / 100mL): weigh 0.36g dissolved in 50mL sterilized ddH2O, filter sterilize

[0052] L-Met (240mg / 100mL): weigh 0.12g dissolved in 50mL sterilized ddH2O, filter sterilize

[0053] Screening medium: 1L YNB + 8.3ml L-His (240mg / 100mL) + 8.3ml L-Leu (720mg / 100mL) + 8.3ml L-Met (240mg / 100mL).

[0054] The Saccharomyces cerevisiae BY4741 that was transferred with the expression vector pYES260 containing the OsMTP11 gene obtained in Example 2 was inoculated into the metal ion-free screening medium (YNB+L-His+L-Leu+L-Met...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a paddy rice heavy metal inducible tissue specific promoter MTP11P and an application thereof. The promoter MTP11P nucleotide sequence is shown as a SEQ ID NO.1-1988 site, the whole length of the sequence is 1988 basic groups. According to the invention, the promoter MTP11P can mainly start the expression of gene in vascular bundle, and induced by a heavy metal. Accordingly, the paddy rice heavy metal inducible tissue specific promoter MTP11P can be used for controlling the expression of metal ions transport protein gene in paddy rice, thereby effectively adjusting theexpression of the metal ions transport protein gene in the vascular bundle and changing the absorption and accumulation of metal ions in plants, also can be used for regulating and controlling the specific expression of the transport protein certain in plant vascular bundle so that the transportation of nutrition, salinity, moisture and the like by plants can be improved.

Description

Technical field: [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to a rice heavy metal-inducible tissue-specific promoter MTP11P and an application thereof. Background technique: [0002] Industrial development has caused serious environmental pollution, especially heavy metal pollution. Metal ions that cause heavy metal pollution mainly include Cd, Zn, Mn, Ni, Hg, etc. Plants are primary producers in the food chain, and their tolerance and accumulation of heavy metals are closely related to human health. So far, many protein families in plants have been found to be related to the uptake and transport of metal ions. These protein families mainly include ZIP (ZRT, IRT-like protein, ZIP), NRAMP (Natural Resistance Associated Macrophage Protein, NRAMP), CAX (cation exchanger, CAX), P1B type ATPase and MTP (Williams L et al. Dissecting Pathways Involved in Manganese Homeostasis and Stress in Higher Plant Cells. 2010....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/63C12N15/84A01H5/00
Inventor 张美刘宝秀
Owner SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI