Triticum aestivum farnesyl phosphate synthase (TaFPS) gene as well as isolation colonizing and enzyme activity measuring method thereof

A technology of farnesyl pyrophosphate and enzyme gene, which is applied in the field of in vitro detection of enzyme activity and can solve problems that have not been disclosed or published

Inactive Publication Date: 2012-05-02
CROP RES INST SHANDONG ACAD OF AGRI SCI
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, farnesyl pyrophosphate synthase genes have been isolated and cloned from 40 plant species including Arabidopsis thaliana, rice (Oryza sativa), corn (Zea mays), sorghum (Sorghum bicolor), and rubber (Hevea brasiliensis). , before the application of the present invention, there has not been disclosed or published about the separation and cloning of the farnesyl pyrophosphate synthase gene TaFPS from wheat (Triticum aestivum), the prokaryotic gene expression of encoding protease, the separation and purification of enzyme protein and its enzyme activity in vitro Research data information such as detection and kinetic parameters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triticum aestivum farnesyl phosphate synthase (TaFPS) gene as well as isolation colonizing and enzyme activity measuring method thereof
  • Triticum aestivum farnesyl phosphate synthase (TaFPS) gene as well as isolation colonizing and enzyme activity measuring method thereof
  • Triticum aestivum farnesyl phosphate synthase (TaFPS) gene as well as isolation colonizing and enzyme activity measuring method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1 (wheat leaf RNA extracts)

[0059] (1) Wheat variety Jinan 13 was grown to the three-leaf stage in a constant temperature incubator (28° C.) with vermiculite.

[0060] (2) Grind the leaves into powder in liquid nitrogen, and transfer them to DEPC-treated EP tubes.

[0061] (3) Add appropriate amount of RNAiso Plus.

[0062] (4) Stand at room temperature for 5 minutes.

[0063] (5) Add 1 / 5 volume of RNAiso Plus in chloroform. Shake until creamy.

[0064] (6) Stand at room temperature for 5 minutes.

[0065] (7) Centrifuge at 12000g for 15 minutes at 4°C.

[0066] (8) Transfer the supernatant to a new DEPC-treated EP tube, add isopropanol equal to the volume of the supernatant, and mix well. Stand at room temperature for 10 minutes.

[0067] (9) Centrifuge at 12000g for 10 minutes at 4°C.

[0068] (10) Add 1 mL of 75% ethanol prepared with DEPC water to the precipitate. Centrifuge at 12000g for 5min at 4°C.

[0069] (11) Keep the precipitate and dry...

Embodiment 2

[0071] Example 2 (synthesis of the first strand of cDNA)

[0072] Follow the instructions of the Takara reverse transcription kit.

[0073] (1) Prepare the following mixture in a microtube

[0074]

[0075] (2) Carry out denaturation and annealing reactions under the following conditions on a PCR instrument: 5 minutes at 65°C—quick cooling on ice.

[0076] (3) Prepare the following reverse transcription reaction solution in the above-mentioned Microtube tube.

[0077]

[0078]

[0079] (4) Carry out the reverse transcription reaction on the PCR instrument according to the following conditions: 42° C., 60 min; 70° C., 15 min; 4° C. cooling.

Embodiment 3

[0080] Embodiment 3 (intermediate sequence amplification)

[0081] 1 Primer design for intermediate sequences

[0082] Using Primer5.0 primer design software and DNAMAN software, primers were designed according to the highly conserved region of the amino acid sequence of FPS in plants.

[0083] Upstream primer DFFPS: 5'TGGTGTATTGAATGGCTTCAAGC3' (Seq ID No: 4)

[0084] Downstream primer DRFPS: 5'TCATCCTGAACTTGAAAGTATGCTCCCAT3'. (Seq ID No: 5)

[0085] The PCR system is: cDNA 2ul, buffer 1.5μL, Taq enzyme 0.3μL, dNTP 0.7μL, DFFPS 0.6μL, DRFFPS 0.6μL, ddH2O 9.8μL.

[0086] The PCR program is: 94°C for 3min, 94°C for 45s, 55°C for 45s, 72°C for 1min, 72°C for 6min, 32cycles.

[0087] 2 PCR result detection of intermediate sequence

[0088] Mix 8 μL of PCR amplification product with 1 μL of bromophenol blue, point it into 1.5% agarose gel, electrophoresis at 120V for 45 min, observe and take pictures with an ultraviolet gel imaging system. like image 3 Shown PCR obtains the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to molecular biology and relates to a technology for isolation colonizing of a triticum aestivum farnesyl phosphate synthase (TaFPS) gene as a key enzyme gene participating in isoprene-like substances such as wheat chlorophyll, carotenoid and the like as well as prokaryotic expression of enzyme protein, separated purification of the enzyme protein and detection in vitro of the enzyme activity. The invention provides important technical storage for further constructing a eukaryotic gene expression vector of the TaFPS gene and converting the eukaryotic gene expression vector into a corresponding crop, particularly obtaining plants with important commercial value by means of secondary metabolism, discussing the relationships between the overexpression of the TaFPS gene in a receptor plant and important economical characters such as a secondary metabolite, the seed size of crops, the grain weight and the like, further improving the yield of the crops, analyzing the structures of an introne, an exon and a promoter of the TaFPS gene, researching the functions of the promoter and developing a relevant molecular marker.

Description

technical field [0001] The invention belongs to the field of molecular biology, and relates to the isolation and cloning of a key enzyme gene farnesyl pyrophosphate synthase gene TaFPS involved in the synthesis of isoprenoid substances such as wheat chlorophyll and carotenoids, the prokaryotic expression of enzyme protein, and the enzyme Protein separation and purification and enzyme activity in vitro detection technology. Background technique [0002] Isoprenoid substances exist in all organisms, especially in plants, and are important organic substances necessary for maintaining plant growth and development, photosynthesis, etc. At present, more than 30,000 plant isoprenoids have been discovered, and this number is still increasing year by year. Such substances have various roles in organisms, and can be used as photosynthetic pigments (such as chlorophyll, carotenoids), growth substances and plant hormones (cytokinins, abscisic acid, gibberellins and brassinosteroids), ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/79C12Q1/48G01N21/31A01H5/00
Inventor楚秀生李玉莲李永波樊庆琦黄承彦刘爱峰高洁隋新霞
OwnerCROP RES INST SHANDONG ACAD OF AGRI SCI