Check patentability & draft patents in minutes with Patsnap Eureka AI!

Trichoderma viride chitinase gene Tvchi and expression product and application thereof

A technology of chitinase gene and Trichoderma viride is applied in application, genetic engineering, plant gene improvement, etc. It can solve the problems of unsatisfactory biological activity and expression, harsh conditions for the existence of activity, and restrictions on application. Achieve the effects of easy preparation and use, low requirements for survival conditions, low production costs and low storage costs

Active Publication Date: 2012-05-02
HENAN ACAD OF AGRI SCI
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current understanding of Trichoderma and its chitinase gene is still very limited, and the biological activity and expression level of the expression products of some existing chitinase genes are not satisfactory, and the use of prokaryotic expression of Trichoderma chitinase Low activity; there are also some chitinases (such as Trichoderma viridans UKM-1 strain chitinase, etc.) that require harsh conditions for the existence of activity, and the cost of preparation and storage is high. These factors restrict their application in biological control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma viride chitinase gene Tvchi and expression product and application thereof
  • Trichoderma viride chitinase gene Tvchi and expression product and application thereof
  • Trichoderma viride chitinase gene Tvchi and expression product and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Tvchi Cloning and sequencing of genes

[0028] (1) Primer design

[0029] Upstream primer TVchi-F: 5′- GGATCC ATGTTGAGCTTCCTCGGCAAAT -3′; downstream primer TVchi-R: 5′- CTCGAG TTAGTTGAGACCCTTCCTGATGT-3′, introduced respectively Bam HI and xho I restriction site (underlined). The above primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0030] (2) Tvchi Gene acquisition

[0031] Extraction and reverse transcription of total RNA: Trichoderma viridans ZBS-6 total RNA extracted by RNAiso® Plus instructions. Reverse transcription was performed according to the instructions of PrimeScript? RT-PCR Kit to obtain the full-length cDNA of ZBS-6.

[0032] PCR amplification Tvchi Gene system (25 μL): 2.5 μL 10×Buffer (Mg 2+ free), 2.5 μL MgCl 2 (25 mM), 0.4 μL dNTP (10mM), 1 μL each of upstream and downstream primers (10 μM), 0.2 μL rTaq polymerase, 6 μL template cDNA (10ng / μL), 11.4 μL ddH2 O. Amplification conditions: 94°C for ...

Embodiment 2

[0037] Example 2: Tvchi Construction of gene prokaryotic expression vector

[0038] The recombinant pMD19-T / Tvchi was incubated at 37°C for 2 h Bam H I and xho After I double enzyme digestion, the fragment of about 1200 bp was recovered, ligated with the prokaryotic expression vector pET-28a that had been digested by the same enzyme, and kept at 16°C overnight under the action of T4 ligase. Transform Escherichia coli JM109, culture overnight at 37°C, 180 r / min, extract recombinant plasmid pET-28a / Tvchi DNA, Bam H I and xho I Enzyme digestion identification.

[0039] pMD19-T-Tvchi Bam HI and xho I double digested, ligated to the same by Bam HI and xho The pET-28a / Tvchi expression vector was constructed on the pET-28a carrier of I double enzyme digestion, and the enzyme digestion results showed that this experiment obtained Tvchi The prokaryotic expression vector pET-28a / Tvchi ( image 3 ). The plasmid was transformed into BL21 (DE3) strain by preparing Es...

Embodiment 3

[0040] Example 3: Tvchi Induced gene expression and protein purification

[0041] The pET-28a / Tvchi plasmid identified by restriction enzyme digestion was transformed into Escherichia coli BL21 (DE3) competent cells, and the correct transformant clone was selected. The specific steps were referred to Yang et al. (Yang LR, Wang ZJ, Xue BG, et al . Clonging of Antagonistic Protein TasA Gene in Bacillus amyloliquefaciens YN-1 and Its Prokaryotic Expression. [J]. Genomics and Applied Biology (Genomics and Applied Biology), 2010, 29 (5): 823-828).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a Trichoderma viride chitinase gene Tvchi and an expression product and application thereof. In the invention, Trichoderma ZBS-6 is taken as an investigated subject to clone Trichoderma viride chitinase gene Tvchi with the nucleotide sequence as shown in SEQ ID NO.1, construct a procaryotic expression carrier of Tvchi and obtain Trichoderma viride chitinase with high bacteria inhibiting activity. The preparation method is simple. As the Trichoderma viride ZBS-6 Tvchi gene is obtained in the invention, important significance is provided for defining the bacteria inhibiting molecule mechanism of ZBS-6 and performing transgenosis research. In the invention, the enzyme activity of the prokaryotically expressed Tvchi raises rapidly at 20-37 DEG C and is the highest at 37 DEG C; the Tvchi has relatively high enzyme activity at pH 6-8, has low requirement on survival conditions and is easy to prepare and use, wherein the optimal PH value is 6.8; the production cost and preservation cost are low; and the Tvchi can be widely applied to biological control of crop diseases.

Description

technical field [0001] The invention belongs to the field of biological technology, and in particular relates to a Trichoderma viride chitinase gene Tvchi and its expression product and application. Background technique [0002] Chitinase is a hydrolase that uses chitin as a substrate. Chitin, also known as chitin or chitin, exists in the body walls of arthropods, nematodes and molluscs, the cell walls of fungi (except oomycetes) and the cell walls of some algae and other organisms. Since it was discovered in 1921 that eubacteria and actinomycetes can form transparent circles on agar containing chitin, thus proving the existence of water-soluble chitinase in these cultures, people have never stopped the research on chitinase. Research, isolate and clone chitinase from various microorganisms (bacteria, actinomycetes, fungi), and conduct a lot of research on the physicochemical characteristics and biological characteristics of microbial chitinase. Chitinase-producing bacteri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/56C12N9/42C12N15/63C12N1/21C12N15/11A01N63/04A01P3/00C12R1/885
Inventor 杨丽荣薛保国全鑫孙虎梁慎武超
Owner HENAN ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com