Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

shRNA molecule of knockdown mouse endogenous CYP3A, recombinant expression vector, its preparation method and application

An expression vector and endogenous technology, applied in the field of shRNA molecules, can solve the problems of low efficiency, high cost and long cycle, and achieve the effect of high efficiency, low cost and short technical cycle

Inactive Publication Date: 2012-05-09
ARMY MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional gene knockout technology based on homologous recombination of ES cell DNA can block the expression of endogenous CYP enzymes in mice, but this technology has a long cycle, low efficiency, and high cost, and because the mouse CYP enzyme superfamily consists of multiple sub- family and dozens of members, so it is extremely difficult to simultaneously block the gene expression of multiple CYP enzyme subfamilies or multiple members through conventional gene knockout technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • shRNA molecule of knockdown mouse endogenous CYP3A, recombinant expression vector, its preparation method and application
  • shRNA molecule of knockdown mouse endogenous CYP3A, recombinant expression vector, its preparation method and application
  • shRNA molecule of knockdown mouse endogenous CYP3A, recombinant expression vector, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Preparation of coding sequences of shRNA molecules

[0023] The mRNA of mouse endogenous CYP3A11, CYP3A41 and CYP3A44 genes has the homologous region of the nucleotide sequence shown in SEQ ID No.1, and the sequence is: 5'-auuaagaaugugcuagugaag-3', so it is shown in SEQ ID No.1 The sequence can be used as the target sequence of shRNA molecule to inhibit CYP3A. The coding sequence of the shRNA molecule that is artificially synthesized to inhibit the expression of mouse endogenous CYP3A, as shown in SEQ ID No.2 nucleotide sequence: 5'-tgctgttgacagtgagcga attaagaatgtgctagtgaagtagtgaagccacagatgtacttcactagcacattcttaat ctgcctactgcctcgga-3', wherein the underlined part is the coding sequence of the shRNA molecule designed in the present invention, and the unlined part is the upstream and downstream primer binding sites respectively. And design primers for amplifying the sequence according to this sequence, the upstream primer is 5'-gatggctgctcgagaaggtatat tgctgttgacagtgagc...

Embodiment 2

[0030] Knockdown of CYP3A Gene Expression in Primary Mouse Hepatocytes Cultured in Vitro

[0031] (1) Culture of primary hepatocytes

[0032] 4-week-old FVB / N mice were killed by necking and dipped in a large beaker containing 75% alcohol for 10 seconds; then the abdomen of the mice was cut open with ophthalmic scissors, and the liver was quickly removed and placed in a 4°C container. Rinse twice in D-Hanks solution containing double antibody, and then cut the mouse liver tissue into 1mm with ophthalmic scissors in the petri dish 3 Put the left and right small pieces into the test tube, blow with a straw, and suck out the supernatant after the tissue is precipitated. Repeat this 3 times. After the last wash, put the test tube into a centrifuge for 4 minutes at 800rpm; take out the centrifuged test tube Discard the supernatant, add trypsin concentration 1.0g / L 10 times the volume of liver tissue, and digest with 37°C digestive solution for about 10-20 minutes, shake once every...

Embodiment 3

[0038] Knockdown of CYP3A gene expression in mice

[0039] (1) Establish a mating male group and a ligation male group

[0040] Take 40 FVB / N male mice with strong males as breeding male mice, and raise them in single cages until they are 6-8 weeks old, and then raise 40 male mice with 1 female mouse in a cage for 2 weeks, and then take out the female mice. To enhance the maleness of the male rats; then the male rats were anesthetized by intraperitoneal injection of 0.5% pentobarbital sodium at 0.8mg / 10g, after finding the vas deferens on the left and right sides, burn them off with red-hot clock forceps and ligate the vas deferens , and then returned to the abdominal cavity, sprinkled a small amount of penicillin / streptomycin into the incision, and sutured the muscle layer and skin abdominal transverse incision respectively; after waking up, they were reared in single cages for 2 weeks, and after they regained their vitality, they were put into 1 estrus female mouse , After ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a shRNA molecule of knockdown mouse endogenous CYP3A. The nucleotide sequence of the shRNA molecule is as shown in SEQID No.6. The invention also discloses a recombinant expression vector pRIME-CMV-eGFP-miR-shRNA containing the shRNA molecule, a preparation method of the vector and an application of the shRNA molecule in the knockdown mouse endogenous CYP3A. Expression of a mouse endogenous CYP3A gene is effectively blocked in transgenic mouse produced by the invention. By the use of the invention, a transgenic mouse model of the knockdown mouse endogenous CYP3A is established and human CYP is expressed in the mouse model. The invention can be applied in drug research and development to make the drug effect index in mouse to be more close to that in human.

Description

technical field [0001] The present invention relates to an shRNA molecule for knocking down mouse endogenous CYP3A enzyme, also relates to a recombinant expression vector containing the shRNA molecule and a construction method of the recombinant expression vector, and also relates to the application of shRNA molecule in knocking down mammalian cell CYP3A enzyme . Background technique [0002] Mice are important model animals widely used in pharmacokinetic and pharmacodynamic studies, and are important tools for drug development. Interspecies differences in the activity of cytochrome P450 enzymes (Cytochromosome P450, CYP) are an important reason why drug metabolism and drug effect indicators cannot be directly analogized from mice and other model animals to humans. Expressing human CYP enzymes in animals through transgenic technology is the most direct means to overcome the differences between CYP enzyme species, but because animal endogenous CYP enzymes often have a wide r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/867C12N15/66A01K67/027
Inventor 王勇魏泓庞浩周晓杨王露露刘昌峨刘勤
Owner ARMY MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com