Method for high-flux screening chemical excitons for inducing insect resistance of plants
A technology for chemical excitation and induction of plants, which is applied in material excitation analysis, biological testing, material inspection products, etc. It can solve the problems of cumbersome methods, low efficiency, and large workload of biological assays, and achieve a simple and simple screening method. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0013] Example 1: Linalool, an important natural enemy of brown planthopper, can attract rice linalool, which is an important natural enemy of brown planthopper, with rice linalool synthase gene. OsLIS As an example, the operation steps of the present invention are introduced.
[0014] 1. Linalool Synthase Gene OsLIS Promoter sequence cloning and pCAMBIA-LISp vector construction
[0015] Design primers based on the OsLIS gene sequence (GenBank accession number is AK110925) 1500bp upstream of the transcription start site:
[0016] The forward primer is OsLISP-F:CG AAGCTT CGTGTTCATGTACCCTTTT, reverse primer is OsLISP-R:AG GTCGAC GTGGCAAACCATAGATAAGC, in order to facilitate the next step of cloning, Hind Ⅲ and Sal Ⅰ restriction sites were designed at the underlined positions. Using rice genomic DNA as a template for PCR amplification, the amplified product was named LISp. The LISp and pCAMBIA1391 plasmids were digested with HindⅢ and SalⅠrespectively, the digested products were ele...
Embodiment 2
[0022] Example 2: Verification test of jasmonic acid as a chemical elicitor
[0023] Jasmonic acid (JA) is a known biologically active small molecule that can activate rice to induce insect resistance. It can not only induce rice to produce direct resistance to stem borers (Zhou G, et al. (2009) Silencing) OsHI-LOX makes rice more susceptible to chewing herbivores, but enhances resistance to a phloem feeder. Plant J 6 0: 638–648.), and can induce indirect resistance in rice (Lou Y, Du MH, Turlings TCJ, Cheng J, Shan WF (2005a) Exogenous application of jasmonic acid induces volatile emissions in rice and enhances parasitism of Nilaparvata lugens eggs by the parasitoid Anagrus nilaparvatae . Journal of Chemical Ecology, 31: 1985-2002). In this example, when JA aerial parts are sprayed, JA is dissolved in 50 mM phosphate buffer to a final concentration of 5 mg / L, and 0.01% Tween-20 is added. In the transgenic rice lines L15-15 and L15-38 Spray 2 ml of solution evenly on the leav...
Embodiment 3
[0024] Example 3: Screening of chemical elicitors from small molecule compounds with unknown activity
[0025] Dissolve 11 different small molecule compounds with unknown biological activity A, B, C, D, E, F, G, H, I, J, K in 50 mM phosphate buffer to a final concentration of 5 mg / L, add 0.01 % Tween-20, spray the aerial part of rice line L15-38 with the same method as in Example 1, and spray 0.01% Tween-20 phosphate buffer as a control. After 48 h of treatment, the GUS protein activity in the leaves was determined. At the same time, the wild-type rice was treated with the same method, and 48 h after the treatment, the behavioral response of the small-molecule treatment of wild-type rice plants and the buffer treatment of wild-type rice plants were measured. The “Y” type olfactory instrument was used to determine the behavioral response of 50 rice louse mites to rice volatiles. For specific steps, please refer to: Lou Y, Du MH, Turlings TCJ, Cheng J, Shan WF (2005a) Exogenous ap...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More