Unlock instant, AI-driven research and patent intelligence for your innovation.

NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus

A detection kit, a highly pathogenic technology, applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve problems such as difficulty in reproduction and respiratory syndrome virus, and achieve the effect of optimizing the reaction temperature

Inactive Publication Date: 2012-07-18
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI +7
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art, and provide a fast, simple, high sensitivity, specificity that can solve the difficulty of diagnosis and prevention and control of highly pathogenic porcine reproductive and respiratory syndrome virus in grassroots veterinary departments Highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection kit to reduce the morbidity and mortality of pig herds, improve breeding efficiency, and promote the sustainable, efficient and healthy development of pig farming

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus
  • NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus
  • NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] A highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection kit, the kit includes the following components: 2mMdNTP, 2.46nM Dig-11-UTP, 10mM Kcl, 40mM Tris-Hcl, 12mMMgCl 2 , 20% DMSO (dimethyl sulfoxide), 5mM DTT, 0.2mM upstream and downstream primers, 8U RNAse H, 40U RNA polymerase, 12U AMV enzyme, BSA, upstream primer is P1: 5ˋ-ACATGACGAGCTGCT-3ˊ, downstream primer P2 : 5ˋ-CTAATACGACTCACTATAGGGAGAAGGGTCCACATCCACACCATC-3ˊ, wherein "CTAATACGACTCACTATAGGGAGAAGG" is the T7 promoter sequence; biotin probe: 5ˊ-biotin-GATGTCGCCGCGGGAGTCT-3ˊ, streptavidin-coated ELISA plate, hybridization solution (30% formamide , 6×SSC, 0.1%SDS, 1×denhardt, 0.1ng / ml denatured salmon sperm DNA), digoxin antibody-POD, substrate POD, 2M sulfuric acid, TBST washing solution, positive control, negative control;

[0055] Described positive control, negative control are to measure OD with microplate reader 490nm The value of positive control OD 490nm The average ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus. The kit comprises 2mM dNTP, 2.46 nMDig-11-UTP, 10 mM KCl, 40 mM Tris-HCl, 12 mMMg Cl2, 20% DMSO (Dimethyl Sulphoxide), 5m DTT (DL-Dithiothreitol), 0.2 mM forward and reverse primers, 8U RNase H, 40 U RNA polymerase, 12 U AMV(Avian Myeloblastosis Virus) enzyme and BSA, the forward primer P1: 5'-ACATGACGAGCTGCT-3', the reverse primer P2: 5'-CTAATACGACTCACTATAGGGAGAAGGGTCCACATCCACACCATC-3', wherein 'CTAATACGACTCACTATAGGGAGAAGG' is a T7 promoter sequence; a biotin probe: 5'-biotin-GATGTCGCCGCGGGAGTCT-3', ELISA plates coated with streptavidin, hybridization liquid consisting of 30% formamide, 6*SSC, 0.1% SDS (Sodium Dodecyl Sulfate), 1*denhardt and 0.1 ng / ml denatured Salmon Testis DNA, digoxin antibody-POD (Peroxidase), substrate POD, 2M sulfuric acid, TBST (Tris Buffered Saline with Tween) washing liquid, a positive control and a negative control. The quick, simple and convenient kit with high sensitivity and strong specificity is provided, and by adopting the kit, difficulty in diagnosis and prevention of the high-pathogenicity reproductive and respiratory syndrome virus by basic veterinarian departments is solved, incidence of diseases and mortality of pig groups are reduced, the cultivation benefits are improved, and continuous, efficient and healthy development of the pig breeding is promoted.

Description

[0001] technical field [0002] The invention relates to a highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection device, in particular to a highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection kit. [0003] Background technique [0004] Highly pathogenic porcine reproductive and respiratory syndrome virus (PRRSV) is an acute and highly lethal epidemic of reproductive disorders and respiratory diseases in pigs caused by mutated porcine reproductive and respiratory syndrome virus. Since the second half of 2006, "high fever" caused by highly pathogenic porcine reproductive and respiratory syndrome virus has caused a large number of pigs to become sick and dead, and has become a huge stumbling block affecting the development of my country's pig industry. Currently, there are many methods for detecting HPRSV, such as virus isolation, RT-PCR and real-time fluorescent RT-PCR. The sensitivi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/70
Inventor 周伦江王隆柏庄向生陈如敬车勇良吴学敏魏宏
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More