NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus

Abstract

The invention discloses an NASBA-ELISA (Nucleic Acid Sequence Based Amplficaiton-Enzyme linked immunosorbent assay) kit of high-pathogenicity reproductive and respiratory syndrome virus. The kit comprises 2mM dNTP, 2.46 nMDig-11-UTP, 10 mM KCl, 40 mM Tris-HCl, 12 mMMg Cl2, 20% DMSO (Dimethyl Sulphoxide), 5m DTT (DL-Dithiothreitol), 0.2 mM forward and reverse primers, 8U RNase H, 40 U RNA polymerase, 12 U AMV(Avian Myeloblastosis Virus) enzyme and BSA, the forward primer P1: 5'-ACATGACGAGCTGCT-3', the reverse primer P2: 5'-CTAATACGACTCACTATAGGGAGAAGGGTCCACATCCACACCATC-3', wherein 'CTAATACGACTCACTATAGGGAGAAGG' is a T7 promoter sequence; a biotin probe: 5'-biotin-GATGTCGCCGCGGGAGTCT-3', ELISA plates coated with streptavidin, hybridization liquid consisting of 30% formamide, 6*SSC, 0.1% SDS (Sodium Dodecyl Sulfate), 1*denhardt and 0.1 ng / ml denatured Salmon Testis DNA, digoxin antibody-POD (Peroxidase), substrate POD, 2M sulfuric acid, TBST (Tris Buffered Saline with Tween) washing liquid, a positive control and a negative control. The quick, simple and convenient kit with high sensitivity and strong specificity is provided, and by adopting the kit, difficulty in diagnosis and prevention of the high-pathogenicity reproductive and respiratory syndrome virus by basic veterinarian departments is solved, incidence of diseases and mortality of pig groups are reduced, the cultivation benefits are improved, and continuous, efficient and healthy development of the pig breeding is promoted.

Description

[0001] technical field [0002] The invention relates to a highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection device, in particular to a highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection kit. [0003] Background technique [0004] Highly pathogenic porcine reproductive and respiratory syndrome virus (PRRSV) is an acute and highly lethal epidemic of reproductive disorders and respiratory diseases in pigs caused by mutated porcine reproductive and respiratory syndrome virus. Since the second half of 2006, "high fever" caused by highly pathogenic porcine reproductive and respiratory syndrome virus has caused a large number of pigs to become sick and dead, and has become a huge stumbling block affecting the development of my country's pig industry. Currently, there are many methods for detecting HPRSV, such as virus isolation, RT-PCR and real-time fluorescent RT-PCR. The sensitivi...

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art, and provide a fast, simple, high sensitivity, specificity that can solve the difficulty of diagnosis and prevention and control of highly pathogenic porcine reproductive and respiratory syndrome virus in grassroots veterinary departments Highly pathogenic porcine reproductive and respiratory syndrome virus NASBA-ELISA detection kit to reduce the morbidity and mortality of pig herds, improve breeding efficiency, and promote the sustainable, efficient and healthy development of pig farming

Images