Fusion protein containing guide peptide and GnRH-PE39KDEL as well as nucleic acid and application thereof

A fusion protein and guide peptide technology, applied in the field of bioengineering, can solve the problems of weak target tissue-specific killing effect, poor infiltration of large solid tumors, serious immune response, etc., and achieves less stringent reaction conditions, high speed, and temperature adaptability. wide effect

Inactive Publication Date: 2012-07-25
BIOLOGY INST OF SHANDONG ACAD OF SCI
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

), the targeting type of these fusion proteins has been widely verified, and can specifically recognize and kill target cells, but there is still a big problem in the application, that is, due to the structural problems of solid tumors, such as The specific killing effect on the target tissue is weak, especially the infiltration of large solid tumors is poor, and the immune response in the body is serious, so how to enhance the cytotoxicity of the PE part of the targeted toxic protein, and develop a drug that only kills the relevant pathology The relevant immunotoxin becomes the key

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein containing guide peptide and GnRH-PE39KDEL as well as nucleic acid and application thereof
  • Fusion protein containing guide peptide and GnRH-PE39KDEL as well as nucleic acid and application thereof
  • Fusion protein containing guide peptide and GnRH-PE39KDEL as well as nucleic acid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Obtaining of GnRH-PTD-PE39KDEL fusion protein gene sequence

[0027] According to the known amino acid sequence of GnRH-PE39KDEL, the GnRH-PE39KDEL gene sequence (completed by Sangon Bioengineering (Shanghai) Co., Ltd.) was synthesized using the preferred codons of Escherichia coli. C-terminus plus a restriction enzyme site.

[0028] The PCR method was used to operate the gene sequence of the whole gene synthesis PE39KDEL, and three primers were designed:

[0029] MiddleCTDF1

[0030] 5'TACAACGCTGGTCGTCGTGCTCGTCGTCGTCGTCGTCGTCACTTCCCGGAAGGTGG

[0031] MiddleCTDF2

[0032] 5’ GGGATCCGTGGAAGGTCGCGAACACTGGTCTTACGGTCTGCGTCCGGGTTACAACGCTGGTCGTCG

[0033] GnRHR 5' GAATTCTCACAGTTCGTCTTTCGG

[0034] A PTD sequence was introduced at the C-terminal of GnRH of GnRH-PE39KDEL, and a Factor Xa protease cleavage site was introduced at the N-terminal of GnRH-PTD-PE39KDEL to obtain the nucleic acid sequence SEQ ID NO:1 encoding the fusion protein of SEQ ID NO:2.

Embodiment 2

[0036] 2.1 Construction of GnRH-PTD-PE39KDEL gene recombinant plasmid:

[0037] Extract the plasmid pET-His with Bam H I and Eco R I double digestion, recovery of 2.8 kb linear plasmid;

[0038] The GnRH-PTD-PE39KDEL gene fragment obtained in the step 1 was used Bam H I and Eco R I double enzyme digestion, add equal volume of phenol: chloroform: isoamyl alcohol (volume ratio 25:24:1) for extraction, 3 times volume of absolute ethanol precipitation to recover the digested fragment;

[0039] Ligate the fragments of the digested products recovered above with T4 DNA ligase, and the ligation reaction system is 25 μl:

[0040]

[0041] The ligation was performed overnight at 16°C, and the ligation product was the pET-His-GnRH-PTD-PE39KDEL recombinant plasmid.

[0042] 2.2 The recombinant plasmid pET-His-GnRH-PTD-PE39KDEL was transformed into Escherichia coli Top 10F to verify the recombination results:

[0043] Take 1 μl of pET-His-GnRH-PTD-PE39KDEL recombinant plasmid,...

Embodiment 3

[0044] Example 3 Construction and screening of engineering strains expressing GnRH-PTD-PE39KDEL

[0045] 3.1 Transformation of recombinant plasmid pET-His-GnRH-PTD-PE39KDEL into expression strain BL21(DE3)plysS

[0046] Take 1 μl of the pET-His-GnRH-PTD-PE39KDEL plasmid constructed in 2.1 above, dilute it 10 times and transform it directly E. coli The expression strain BL21(DE3)plysS competent cells were spread on LB+Amp plates and cultured upside down at 37°C overnight.

[0047] 3.2 Screen the engineering strain GnRH-PTD-PE39KDEL / pET-His expressing GnRH-PTD-PE39KDEL

[0048] Pick 4 monoclonal colonies from the above LB plate, shake overnight culture in 2ml LB+Amp liquid medium at 37°C, take 20 μl overnight culture medium and add it to 2 ml YTA+Amp liquid medium for transfer culture, 37 Cultivate with shaking at °C for 3 hours until the OD600 is between 0.5 and 0.7, then add IPTG to a final concentration of 0.3mM, and induce expression at 30°C for 3-8 hours with sha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a novel fusion protein. A peptide segment (preferably a protein transduction domain (PTD)) is introduced, so as to improve the cell killing activity of an immunotoxin human leuterinizing hormone releasing hormone-Pseudomonas aeruginosa exotoxin A derivative (GnRH-PE39KDEL), and the peptide segment is positioned on the C-terminal of the human leuteinizing hormone releasing hormone (GnRH) and the N-terminal of the Pseudomonas aeruginosa exotoxin A derivative (PE39KDEL) to form the novel fusion protein together with the GnRH and PE39KDEL. The invention also relates to a nucleotide sequence for coding the fusion protein, an expression vector containing the nucleotide sequence, a host cell containing the expression vector and an application of the novel fusion protein used as an immunotoxin in an anti-cancer medicine.

Description

technical field [0001] The invention belongs to the field of biological engineering. Specifically, it is a new fusion protein and its application in medicine. The invention discloses an immunotoxin (human luteinizing hormone-releasing hormone-Pseudomonas aeruginosa exotoxin A derivative (GnRH-PE39KDEL)) cell killing activity is improved by introducing peptides (preferably protein transduction domain (PTD)) , the peptide is positioned at the C-terminus of human luteinizing hormone-releasing hormone (GnRH) and the N-terminus of Pseudomonas aeruginosa exotoxin A derivative (PE39KDEL) and forms a new fusion protein with GnRH and PE39KDEL, and encodes the fusion protein The nucleotide sequence of protein coding, the expression vector containing said sequence and the host cell containing this expression vector and the application of immunotoxin in antitumor drug. Background technique [0002] At present, the treatment of cancer is still a problem in the world. The main treatment...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N1/21A61K47/48A61K38/16A61P35/00C12R1/19
Inventor扈进冬杨合同李纪顺魏艳丽郭凯
OwnerBIOLOGY INST OF SHANDONG ACAD OF SCI