Gene engineering bacterial strain generating succinic acid and method of producing succinic acid by fermentation of the gene engineering bacterial strain

A genetically engineered bacteria, a technology for producing succinic acid, which is applied in the field of bioengineering and can solve the problems of reduced pyruvate metabolic branches, accumulation of pyruvate, and inability of strains to utilize glucose.

Inactive Publication Date: 2012-07-25
NANJING TECH UNIV
View PDF3 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, E. coli NZN111 inactivated pyruvate formate lyase and lactate dehydrogenase at the same time, the metabolic branch of pyruvate was greatly reduced, and a large amount of pyruvate accumulated, which eventually led to the strain under anaerobic conditions. unable to utilize glucose

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene engineering bacterial strain generating succinic acid and method of producing succinic acid by fermentation of the gene engineering bacterial strain
  • Gene engineering bacterial strain generating succinic acid and method of producing succinic acid by fermentation of the gene engineering bacterial strain
  • Gene engineering bacterial strain generating succinic acid and method of producing succinic acid by fermentation of the gene engineering bacterial strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] This example illustrates the use of homologous recombination technology to knock out the glucose-specific transport system in the starting strain NZN111 ptsG gene, resulting in the elimination of chloramphenicol-resistant strains.

[0043] 1. Using LB medium, cultivate Escherichia coli NZN111 to OD at 37°C under aerobic conditions 600 =0.4~0.6, prepared to be electrotransfer competent.

[0044] 2. Electrotransform plasmid pKD46 into competent Escherichia coli NZN111. The electric shock conditions were: 200 Ω, 25 μF, electric shock voltage 2.3 kV, electric shock time 4-5 ms. Immediately after the electric shock, the cells were added to pre-cooled 1 mL SOC medium, cultured at 150 r / min, 30°C for 1 h, and then spread on the LB medium plate with ampicillin (amp) to screen the positive transformant Escherichia coli NZN111 ( pKD46).

[0045] 3. Add 10 mM L-arabinose to LB medium, induce plasmid pKD46 to express λ recombinase at 30°C, and make electroporation competent. ...

Embodiment 2

[0057] This example illustrates the construction of an expression plasmid expressing exogenous pyruvate carboxykinase to obtain a bacterial strain Escherichia coli BA103, such as Figure 4 Schematic construction shown.

[0058] 1. Construct pTrc99a- pyc Plasmids, the process of which involves:

[0059] (1) synthetic with Nco I and Pst Primers for I restriction sites,

[0060] Upstream primer: 5'- CATGCCATGGTCAGCTGATGAGAAACGTCGAGAAG -3';

[0061] Downstream primer: 5'- AAAACTGCAGGGTCATTCTCTTCAAAGCCAAAACGA-3'.

[0062] (2) to Lactococcus lactis cremoris NZ9000 genomic DNA was used as a template, and the target gene fragment was amplified by PCR. The reaction conditions were: 94°C, 5 min; (94°C for 45 s, 53°C for 45 s, 72°C for 300 s, 35 cycles); 72°C, 10 min. purified amplified pyc After the gene, the expression plasmid was used respectively with pTrc99a Nco I and Pst I double digestion, connection to obtain recombinant plasmid pTrc99a- pyc . PCR amplifie...

Embodiment 3

[0065] This example illustrates the knockout of the glucose-specific transport system in Escherichia coli NZN111 ptsG gene and introduced into plasmid pTrc99a- pyc Finally, glucose can be used efficiently, and the main product is succinic acid, without the accumulation of formic acid and lactic acid, and the generation of by-product pyruvic acid is greatly reduced.

[0066] Escherichia coli BA103 was inoculated into the aerobic stage fermentation medium with 1% (v / v) inoculum for aerobic culture, when the aerobic culture OD 600 Induced to 0.4-0.6 with 0.5 mM IPTG to OD 600 =3, transfer to the anaerobic stage fermentation medium for anaerobic fermentation for 48 hours according to 3 times the inoculum amount of the sludge.

[0067] The medium in the aerobic stage is: LB+Amp+Chl+Kna (50 μg / mL each of ampicillin, chloramphenicol, and kanamycin).

[0068] The medium for anaerobic serum bottle fermentation is: LB+glucose (20g / L)+basic magnesium carbonate 0.48g+Amp+Chl+Kna (50 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biological engineering, relates to a gene engineering bacterial strain generating succinic acid and a method of producing succinic acid by fermentation of the gene engineering bacterial strain, particularly to a gene engineering bacterial strain generating succinic acid, namely Escherichia coli BA103, by high-efficiency use of glucose, a construction method of Escherichia coli BA103 and a method of producing succinic acid by Escherichia coli BA103. By expression of an exogenous pyruvate carboxylase, recombinant Escherichia coli can grow by use of glucose metabolism, so that the yield of succinic acid is greatly increased, the generation intensity is greatly improved, and the generation of pyruvic acid as a by-product is reduced.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and relates to a succinic acid-producing genetically engineered bacterium and a method for fermenting and producing succinic acid, in particular to a recombinant bacterial strain that efficiently utilizes glucose to grow and produce succinic acid, and uses the strain to ferment and produce succinic acid. Succinic acid method. Background technique [0002] As a C4 platform compound, succinic acid (also known as succinic acid) is not only widely used in industries such as medicine, pesticides, dyes, spices, paints, food and plastics, but also for the synthesis of 1,4-butanediol, tetrahydrofuran , γ-butyrolactone and other organic chemicals, as well as polybutylene succinate (PBS) biodegradable materials, are considered by the US Department of Energy to be one of the 12 most valuable biorefinery products in the future. At present, succinic acid for industrial application is mainly produced ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12P7/46C12R1/19
Inventor姜岷苟冬梅梁丽亚刘嵘明张常青马江锋陈可泉韦萍
OwnerNANJING TECH UNIV