Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof

A hybridoma cell line and monoclonal antibody technology, applied in the field of cell engineering, can solve the problems of limited protein application and high price, and achieve the effects of easy survival, reduced production cost and high titer

Active Publication Date: 2012-08-15
GUANGZHOU DARUI BIOTECH
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the antibody products that can detect GPG3 are the products of some foreign companies such as BioMosaics, which are expensive, which limits the application of this protein in clinical target verification and functional research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof
  • GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof
  • GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Preparation of GPC3 recombinant protein

[0024] 1. Construction of GPC3 / PET-11b recombinant vector

[0025] According to the human GPC3 mRNA (NM_001164619) sequence provided in GenBank, the N-terminal signal peptide was removed, and a pair of primers were designed for bases 72-369 of the sequence. The upstream primer: 5' TAATGAATTCATGCAGCCCCCGCCGCC 3' (SEQ ID NO: 1) downstream primer: 5' AGCGGTCGACTCACTTGGCATGGCGAACAACAA 3' (SEQ ID NO: 2). Introduced at the 5' ends of the two primers Eco RI and Sal Ⅰ Restriction site, using the conventional PCR method to use the cDNA of Huh7 (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) total RNA as a template to transfer the GPC3 N-terminal gene, and agarose gel electrophoresis showed that the GPC3 N-terminal was successfully obtained gene, the fragment length was as expected ( figure 1 ).

[0026] The prokaryotic expression vector PET-11b (purchased from Merck Chemicals) and the GPC3 gene fragmen...

Embodiment 2

[0032] Example 2 Preparation of mouse anti-human GPC3 monoclonal antibody

[0033] 1. Establishment of Hybridoma Cell Lines

[0034] (1) Mouse immunization

[0035] The purified GPC3 recombinant protein was mixed with 250 μL of Bentonite adjuvant, and 100 μg / 500 μL of BALB / c mice was subcutaneously injected into BALB / c mice at multiple points. / c mice, starting from the third immunization, the mouse blood was collected from the tail vein in the second week after each immunization, and the serum titer reached 1:50,000 or more by indirect ELISA. A booster immunization was injected once, and the antigen dose was 100 μg.

[0036] (2) Determination of immune serum titer

[0037] Immune serum titers were determined by indirect ELISA. Dissolve 30 μl of GPC3 recombinant protein in 10 mL of 0.05 M pH9.6 carbonate buffer, coat a polystyrene micro-96-well plate, 100 μL / well, and store at 4 °C overnight. The next day, the plate was washed three times with PBS (containing 0.1% (V / V)...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses a GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and a preparation method and application thereof, which belong to the technical field of bioengineering. The GPC3 monoclonal antibody hybridoma cell strain 7D11 has a preservation code of CGMCC No.5426. The preparation method of the hybridoma cell strain 7D11 includes: using GPC3 protein as an immunogen to immunize a mouse, subjecting spleen cells of the mouse with serum titer more than 1:104 and myeloma cells SP2 / 0 to fusion, using a HATRPMI-1640 medium to screen fused cells, screening by ELISA (enzyme-linked immuno sorbent assay) and multiple limiting dilution process, and finally obtaining the hybridoma cell strain 7D11. The GPC3 monoclonal antibody hybridoma cell strain 7D11 is high in yield of secreted antibodies and easy to survive, the secreted monoclonal antibodies are high in titer, flexible in reaction, easy to detect, low in production cost and widely applicable to detection of GPC3 protein expression.

Description

technical field [0001] The invention relates to the technical field of cell engineering, in particular to a GPC3 monoclonal antibody hybridoma cell line 7D11 and a preparation method and application thereof. Background technique [0002] Hepatocellular carcinoma (hepatocellular carcinoma, HCC) is one of the most common malignant tumors in the world, which seriously endangers human life and health. According to reports, among all diseases, the incidence of hepatocellular carcinoma ranks fifth and the mortality rate ranks third three. It is estimated that there are more than 1 million newly discovered HCC patients and about 1 million deaths worldwide every year. Because the early symptoms and signs of HCC are not obvious or lack of specificity, the early diagnosis rate of HCC is low, and patients often seek medical treatment in the middle and late stage, losing the chance of treatment (research shows that early and mid-stage HCC can be treated surgically, and small liver canc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/20C07K16/18G01N33/68C12R1/91
Inventor 马瑞娟徐伟文李明
Owner GUANGZHOU DARUI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com