GPC3 (glypican-3) monoclonal antibody hybridoma cell strain 7D11 and preparation method and application thereof
A hybridoma cell line and monoclonal antibody technology, applied in the field of cell engineering, can solve the problems of limited protein application and high price, and achieve the effects of easy survival, reduced production cost and high titer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Preparation of GPC3 recombinant protein
[0024] 1. Construction of GPC3 / PET-11b recombinant vector
[0025] According to the human GPC3 mRNA (NM_001164619) sequence provided in GenBank, the N-terminal signal peptide was removed, and a pair of primers were designed for bases 72-369 of the sequence. The upstream primer: 5' TAATGAATTCATGCAGCCCCCGCCGCC 3' (SEQ ID NO: 1) downstream primer: 5' AGCGGTCGACTCACTTGGCATGGCGAACAACAA 3' (SEQ ID NO: 2). Introduced at the 5' ends of the two primers Eco RI and Sal Ⅰ Restriction site, using the conventional PCR method to use the cDNA of Huh7 (purchased from Shanghai Cell Bank, Chinese Academy of Sciences) total RNA as a template to transfer the GPC3 N-terminal gene, and agarose gel electrophoresis showed that the GPC3 N-terminal was successfully obtained gene, the fragment length was as expected ( figure 1 ).
[0026] The prokaryotic expression vector PET-11b (purchased from Merck Chemicals) and the GPC3 gene fragmen...
Embodiment 2
[0032] Example 2 Preparation of mouse anti-human GPC3 monoclonal antibody
[0033] 1. Establishment of Hybridoma Cell Lines
[0034] (1) Mouse immunization
[0035] The purified GPC3 recombinant protein was mixed with 250 μL of Bentonite adjuvant, and 100 μg / 500 μL of BALB / c mice was subcutaneously injected into BALB / c mice at multiple points. / c mice, starting from the third immunization, the mouse blood was collected from the tail vein in the second week after each immunization, and the serum titer reached 1:50,000 or more by indirect ELISA. A booster immunization was injected once, and the antigen dose was 100 μg.
[0036] (2) Determination of immune serum titer
[0037] Immune serum titers were determined by indirect ELISA. Dissolve 30 μl of GPC3 recombinant protein in 10 mL of 0.05 M pH9.6 carbonate buffer, coat a polystyrene micro-96-well plate, 100 μL / well, and store at 4 °C overnight. The next day, the plate was washed three times with PBS (containing 0.1% (V / V)...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
