Brevibacillus parabrevis as well as method and application of protein series prepared thereby

A technology of Bacillus brevis and species, which is applied in the field of Bacillus brevis and its prepared protein series and applications, and can solve the problems of short half-life, easy to cause internal bleeding, low specificity of thrombolysis, etc.

Inactive Publication Date: 2012-08-22
GUIZHOU UNIV
View PDF1 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved in the present invention is: to overcome the shortcomings of the existing antithrombotic drugs, such as low thrombolytic specificity, short half-life, and easy to cause internal bleeding, the present invention provides a class of Bacillus brevis GYZC01, with a molecular weight greater than 7000D protein series can be used to prepare thrombolytic drugs with good effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Brevibacillus parabrevis as well as method and application of protein series prepared thereby
  • Brevibacillus parabrevis as well as method and application of protein series prepared thereby
  • Brevibacillus parabrevis as well as method and application of protein series prepared thereby

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1: Determination of the 16S rRNA sequence of Bacillus brevius GYZC01

[0023] 1. Genome extraction and electrophoresis detection

[0024] 1. Genome extraction process:

[0025] Extract according to the instructions of Sangon SK1201-UNIQ-10 Column Bacterial Genomic DNA Extraction Kit.

[0026] 2. Genome electrophoresis analysis map: see the attached manual figure 2

[0027] 2. PCR reaction

[0028] 1. PCR system establishment (50ul):

[0029] Template (genome) 10pmol

[0030] Primer up (10uM) 1ul

[0031] Primer down (10uM) 1ul

[0032] dNTP mix (10Mm each) 1ul

[0033] 10*Taq reaction buffer 5ul

[0034] Taq (5u / ul) 0.25ul

[0035] Add water to 50ul

[0036] PCR program setting

[0037] Pre-denaturation at 98°C 5mim;

[0038] Cycle 95°C 35S, 55°C 35S, 72°C 1min 30s, 35 cycles, extension 8min.

[0039] 3. Electrophoretic pattern of PCR products

[0040] 4. Primer sequence:

[0041] 27f 5'AGAGTTTGATCCTGGCTCAG 3' 20bp

[0042] 1492r 5' GGTTACCT...

Embodiment 2

[0047] Example 2: Preparation of protein series with a molecular weight greater than 7000D of Bacillus brevus strain GYZC01

[0048] 1. Experimental materials

[0049] Brevibacillus parabrevis GYZC01 strain, peptone, sodium chloride, glucose, dialysis bag, ammonium sulfate.

[0050] 2. Experimental method

[0051] 2.1 Bacterial culture

[0052] Composition of bacterial culture medium: peptone 1g, sodium chloride 0.5g, glucose 1.5g, distilled water 100ml, autoclaved for later use. Bacteria were inoculated in 100ml of culture solution and cultured at 30°C for 48h to obtain seeds. According to the ratio of 1 to 100, the seed bacteria solution was added to the culture solution, 5 L was co-cultured, and the culture was statically cultivated at 30°C for 96-120 hours for later use.

[0053] Bacterial fermentation broth (5L) was frozen overnight, thawed at room temperature, and then frozen overnight, and this was repeated 3 times to obtain a frozen lysate, which was centrifuged...

Embodiment 3

[0055] Embodiment 3: In vitro thrombolysis test of Bacillus brevus strain GYZC01 molecular weight greater than 7000D protein series

[0056] 1. Experimental materials

[0057] Crude protein with a molecular weight greater than 7000D of Bacillus brevis GYZC01 strain, capillary, urokinase, plate; 2. Experimental method

[0058] Disinfect the ring finger with alcohol, collect blood by acupuncture, inhale the blood with a capillary, place it horizontally, and the blood will coagulate in about 10 minutes. Dissolve the crude protein of Bacillus brevius GYZC01 strain with normal saline to make sample solutions with series concentrations. Urokinase is used as positive control and normal saline is used as negative control. The above samples, positive control and negative control solutions are placed in 60mm plates respectively. 1. Cut the capillaries with blood clots into 5mm lengths, put them into petri dishes, 5 capillaries per dish, make them immersed in the liquid, put the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Pre-denaturedaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses brevibacillus parabrevis as well as a method and application of a protein series prepared thereby. The classification is named as brevibacillus parabrevis GYZC01, CCTCC NO:M2011461; 16SrRNA of the brevibacillus parabrevis has a sequence of SEQ ID NO:1; the protein series prepared by the brevibacillu sparabrevis GYZC01 strain can be used for preparing thrombolytic medicine, can be used for slowly dissolving thrombus and has durability (EC50 being 200), and can be used for effectively dissolving fresh thrombus (EC50 being 400); and aiming at old thrombus, the activity ofGYZC01 strain crude protein is obviously stronger than that of urokinase (EC50 being 800).

Description

technical field [0001] The present invention relates to a kind of Bacillus brevius and the method and application of the protein series prepared therefrom. Background technique [0002] The mortality rate of cardiovascular and cerebrovascular diseases has always been in the second place, among which thrombotic diseases have the highest morbidity, disability and mortality. Thrombotic disease refers to a type of disease in which thrombus forms in the circulating blood and the thrombus falls off from the local area and flows into the front blood vessel, blocking or partially blocking the vascular lumen, leading to thromboembolism. For thrombotic diseases, there are currently three clinical therapies: surgery, antithrombotic therapy, and thrombolytic therapy. Surgical treatment must identify the location of embolism, which is difficult and dangerous to implement; antithrombotic therapy is to use drugs to control thrombus re-formation, but it is ineffective for already formed th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20C07K14/195C07K1/36C07K1/34C07K1/30A61K38/16A61P7/02C12R1/01
Inventor杨再昌杨小生宋丹丹陆伦维杜润孜
OwnerGUIZHOU UNIV