Encoding gene of type I pullulanase as well as recombinant expression and application thereof

A kind of pullulanase encoding and pullulanase technology, which is applied to the cloning of the pullulanase encoding gene of Aeromonas sp. In the field of lulanase preparation, it can solve problems such as difficulties in recombinant expression

Inactive Publication Date: 2012-09-19
FUDAN UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the pullulanase coding gene sequence is usually long (3-6 kb), which makes its recombinant expression difficult, and there are few reports on the recombinant expression of pullulan gene in China

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding gene of type I pullulanase as well as recombinant expression and application thereof
  • Encoding gene of type I pullulanase as well as recombinant expression and application thereof
  • Encoding gene of type I pullulanase as well as recombinant expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1: obtain by PCR method Aeromonas sp. As pullulanase full-length gene pluAs

[0045] By comparing the reported pullulanase genes of Aeromonas genus (derived from the information obtained after the whole genome sequencing of enzyme-producing strains), look for the conserved regions at the 5' and 3' ends of the gene (see image 3 ), design PCR primers Aero-F and Aero-R as follows:

[0046]Aero-F: ATGGATATGAAAAAGACCAAAGTGGCG (forward primer, without restriction site), that is, SEQ ID NO 3.

[0047] Aero-R: CTTGRCRCKGCACTCCTGRATSACRGCRGTACC (reverse primer, no restriction site), namely SEQ ID NO 4.

[0048] by Aeromonas sp. The As genome was used as a template, and PCR amplification was performed with the above primers. After the PCR amplification product was recovered, it was connected to the pMD18-T vector, transformed into the Escherichia coli Top10 strain, and the plasmid pT-pluAs was obtained, and the sequencing results were performed using the ...

Embodiment 2

[0049] Embodiment 2: obtain by PCR method pluAs- 1 and the preparation of Escherichia coli Rosetta genetically engineered bacteria

[0050] The present invention has amplified such as by PCR method figure 2 shown pluAs The gene fragments are: the four core domains of the PluAs protein (amino acids 22-1114, PluAs-1), the gene fragments without the PUD domain (amino acids 149-1344, PluAs-2), Gram-negative bacteria The conserved domain of pullulanase (amino acids 149-1114, PluAs-3). The Escherichia coli recombinant expression plasmids are pPET21a-PluAs-1, pPET21a-PluAs-2, and pPET21a-PluAs-3, and the C-terminus of the recombinant expression protein has a fusion-expressed 6×His tag.

[0051] Design PCR primers Pul-F64 and Pul-R3342 to amplify PluAs-1 as follows:

[0052] Pul-F64: CCC GAATTC TGTAACGACAACAGTTCTTCACCCTCC (forward primer, containing Eco RI restriction site), that is, SEQ ID NO 5.

[0053] Pul-R3342: CCC GCGGCCGC CCCCAAGAAGCCACGGACAAACA (reverse prime...

Embodiment 3

[0062] Example 3: Analysis of Enzymatic Characteristics of Recombinantly Expressed Pullulanase

[0063] (1) Determination of the optimum pH value: Prepare buffers with pH 3.0-10.0 containing 1% pullulan, among which pH 3.0-6.0 is 20mM citric acid-trisodium citrate buffer, and pH 7.0 is 20mM NaH 2 PO 4 -Na 2 HPO 4 Buffer, pH 8.0~10.5 is 20mM Tris-HCl buffer, pH 11.0 is 20mM glycine-NaOH buffer. Take 98 μL of the buffer solution containing the substrate and 2 μL of the purified enzyme solution and react in a water bath at 60°C for 10 min. Determination of pullulanase activity, wherein the highest enzyme activity is set to 100% (such as Figure 5 ).

[0064] (2) Determination of the optimum reaction temperature: Mix 2 μL of the purified enzyme solution with 98 μL of Tris-HCl containing 1% pullulan (pH 8.0), and mix them at 20, 30, 40, 50, 60 , reacted at 70 and 80 °C for 10 min, and then measured the activity of pullulanase by DNS method, among which the highest enzyme ac...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical fields of gene engineering and protein engineering, and particularly relates to an encoding gene of a type I pullulanase as well as recombinant expression and application of the encoding gene. According to the invention, a novel pullulanase gene derived from aeromonas is provided, and the nucleotide sequence of the novel pullulanase gene is shown in SEQ IDNO1, namely pluAs. The pullulanase is the type I pullulanase which can degrade alpha-1,6 glucose glycosidic bonds in pulullan polysaccharide or starch. Three types of DNA segments with the activity of the type I pullulanase for expressing the gene are recombined, wherein the optimum pH of each recombinant pullulanase segment is 8.0, and the optimum reaction temperature is 60 DEG C; when the pullulanase is treated at the temperature of 55 DEG C for 1 hour, the residual activity of the pullulanase reaches about 90 percent; and the pullulanase is very stable under the condition that the pH is 7 to 10. When the recombinant pullulanase and a diastase are used for the synergistic saccharification of the starch, a product with higher glucose content can be prepared. The combined pullulanase provided by the invention can be applied to the industries of starch processing, environmental conservation, food, health care and the like.

Description

technical field [0001] The invention belongs to the technical fields of genetic engineering and protein engineering, and in particular relates to the cloning of a pullulanase-encoding gene of an Aeromonas genus pullulanase-producing strain. The invention also provides the construction of the recombinant plasmid of the pullulanase coding gene and the preparation method of the recombinant pullulanase. Background technique [0002] Type I pullulanase (EC 3.2.1.41) specifically hydrolyzes the α-1,6-glucosidic bond of pullulan in an endo-cutting manner, and its hydrolyzed product is mainly maltotriose (Doman-Pytka M et al ., Critical Reviews in Microbiology, 2004, Vol 30, Issue 2, 107-121). In addition to degrading pullulan polysaccharide, pullulanase can also hydrolyze starch and amylopectin, so type I pullulanase has very important application value. For example: type I pullulanase can cooperate with α-amylase, β-amylase, etc. to produce high glucose syrup, ultra-high maltose...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/56C12N9/44C12N15/63C12N15/70C12N15/81C12P19/16C12R1/01
Inventor吕红冯碧薇王儒恺周峻岗
OwnerFUDAN UNIV