Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Pig muscle-specific ITGB1BP2 promoter and application thereof

A technology of promoter and muscle, applied in the field of pig genetic engineering

Inactive Publication Date: 2012-10-24
HUAZHONG AGRI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The study of this gene has not been reported in pigs so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pig muscle-specific ITGB1BP2 promoter and application thereof
  • Pig muscle-specific ITGB1BP2 promoter and application thereof
  • Pig muscle-specific ITGB1BP2 promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 The extraction of pig genome DNA and RNA and the synthesis of cDNA

[0059] Using TRIzol reagent (purchased from Invitrogen, operated according to the instructions provided by the reagent) to simultaneously extract DNA and RNA from different tissues of Large White pigs (sourced from the experimental pig farm of Huazhong Agricultural University, which is a conventionally reported variety and an introduced foreign variety), Specific steps are as follows:

[0060] (1) Grind different groups of pig tissues (such as muscle, heart, liver, spleen, lung, and kidney) in liquid nitrogen, add 1ml TRIzol to each 50-100mg tissue, and homogenize with a homogenizer. After the homogenized sample was left at room temperature for 5 minutes, chloroform was added (approximately 0.2ml for every 1ml of TRIzol used), shaken vigorously for 15s immediately after the addition, and left at room temperature for 3 minutes. After centrifugation at 4°C and 12000×g for 15 min, the sample wi...

Embodiment 2

[0072] Example 2 Expression profile of porcine ITGB1BP2 gene in different tissues of Large White pig

[0073] According to the mRNA sequence of the porcine ITGB1BP2 gene (accession number: DQ002920), the following primer pairs for porcine ITGB1BP2 expression profile analysis were designed:

[0074] Forward primer ITGB1BP2qF: 5'GATTCCACTTCCTGCGTTCA3';

[0075] Reverse primer ITGB1BP2qR: 5'CGAGATGGCATCAAGGAGAC3'.

[0076] The heart, liver, spleen, lung, kidney, small intestine, longissimus dorsi, and back fat cDNA of 2-month-old Large White pigs were used as templates, and pig β-actin gene was used as internal reference. The primers for β-actin were as follows:

[0077] β-actin-qPCR-F: 5'CCAGGTCATCATCACCATCGG3';

[0078] β-actin-qPCR-R: 5'CCGTGTTGGCGTAGAGGT3'.

[0079] Real-time quantitative PCR was performed in LightCycler480 instrument of Roche Company using SYBR Green I fluorescent dye (purchased from Invitrogen Company). Use 2 -ΔΔCt method for data analysis. The test r...

Embodiment 3

[0085] Example 3 Cloning of porcine ITGB1BP2 promoter

[0086] Using the mRNA sequence of the porcine ITGB1BP2 gene (accession number: DQ002920) as a seed, it was compared in the porcine genome, and the following primers for porcine ITGB1BP2 promoter amplification were designed according to its 5' flanking sequence:

[0087] Forward primer ITGB1BP2pF: 5'GTAGGGGATTCCTCCAAT3';

[0088] Reverse primer ITGB1BP2pR: 5'CCACAGCCTTTGTTATGG3'.

[0089] Using large white pig genomic DNA as a template, carry out PCR amplification, the results are shown in figure 2 shown.

[0090] See Table 5 and Table 6 for the PCR reaction system and PCR reaction conditions.

[0091] Table 5 PCR reaction system

[0092]

[0093] Use BioTeKe's Gel Purification Kit (Spin-column) kit (operate according to the instructions of the kit) to recover the PCR amplification product, and clone it into the pMD18-T vector (Promega Beijing Biotechnology Co., Ltd., the U.S. Promega Company in China), extracted ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of pig molecule genetics, and specifically relates to cloning identification of a pig muscle-specific expression gene integrin beta 1 binding protein 2 (ITGB1BP2) promoter, and an application thereof. The steps of the present invention comprise: extracting total RNA of different tissues of a large white pig, and carrying out fluorescence quantitative PCR to determine specific expression in muscle tissue. According to the present invention, the total DNA of the muscle tissue of the large white pig is adopted as a template to design primers; PCR amplification is performed to obtain a 1442 bp sequence of flank on 5' terminal of pig ITGB1BP2 gene; luciferase reporter gene plasmids of 15 ITGB1BP2 promoter deletion fragments with different lengths are constructed; and C2C12 cells are transfected with the plasmids, activity of the promoter of each deletion fragment is detected, and the pig ITGB1BP2 gene promoter is identified. The nucleotide sequence of the pig ITGB1BP2 gene promoter of the present invention is represented by SEQ ID NO:1. With the present invention, import elements and means are provided for pig genetic improvement and transgene, and muscle tissue specificity and stability of transgene expression can be strengthened.

Description

technical field [0001] The invention belongs to the technical field of pig genetic engineering, and specifically relates to a new promoter sequence, which can regulate the expression of target gene ITGB1BP2. The invention includes the cloning, identification and application of the pig ITGB1BP2 promoter. Background technique [0002] ITGB1BP2 (integrin beta 1 binding protein 2) encodes integrin β1 binding protein 2, also known as Melusin, which binds to the membrane proximal region of integrin β1 cytoplasmic region, is a muscle tissue-specific protein, and its role is equivalent to integrin The biomechanical sensor of the pathway is involved in the regulation of the integrin-mediated cell signal transduction system, controlling the expression of genes and the growth and survival of cells, and plays an important role in the process of muscle cell maturation and tissue formation. Immunofluorescence showed that ITGB1BP2, together with integrins and vinculin, is located in the ri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113A01K67/027
Inventor 徐德全熊远著张子见
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com