Pig muscle-specific ITGB1BP2 promoter and application thereof
A technology of promoter and muscle, applied in the field of pig genetic engineering
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1 The extraction of pig genome DNA and RNA and the synthesis of cDNA
[0059] Using TRIzol reagent (purchased from Invitrogen, operated according to the instructions provided by the reagent) to simultaneously extract DNA and RNA from different tissues of Large White pigs (sourced from the experimental pig farm of Huazhong Agricultural University, which is a conventionally reported variety and an introduced foreign variety), Specific steps are as follows:
[0060] (1) Grind different groups of pig tissues (such as muscle, heart, liver, spleen, lung, and kidney) in liquid nitrogen, add 1ml TRIzol to each 50-100mg tissue, and homogenize with a homogenizer. After the homogenized sample was left at room temperature for 5 minutes, chloroform was added (approximately 0.2ml for every 1ml of TRIzol used), shaken vigorously for 15s immediately after the addition, and left at room temperature for 3 minutes. After centrifugation at 4°C and 12000×g for 15 min, the sample wi...
Embodiment 2
[0072] Example 2 Expression profile of porcine ITGB1BP2 gene in different tissues of Large White pig
[0073] According to the mRNA sequence of the porcine ITGB1BP2 gene (accession number: DQ002920), the following primer pairs for porcine ITGB1BP2 expression profile analysis were designed:
[0074] Forward primer ITGB1BP2qF: 5'GATTCCACTTCCTGCGTTCA3';
[0075] Reverse primer ITGB1BP2qR: 5'CGAGATGGCATCAAGGAGAC3'.
[0076] The heart, liver, spleen, lung, kidney, small intestine, longissimus dorsi, and back fat cDNA of 2-month-old Large White pigs were used as templates, and pig β-actin gene was used as internal reference. The primers for β-actin were as follows:
[0077] β-actin-qPCR-F: 5'CCAGGTCATCATCACCATCGG3';
[0078] β-actin-qPCR-R: 5'CCGTGTTGGCGTAGAGGT3'.
[0079] Using SYBR Green I fluorescent dye (purchased from Invitrogen Company), real-time quantitative PCR was performed in LightCycler480 instrument of Roche Company. Use 2 -ΔΔCt method for data analysis. The test ...
Embodiment 3
[0085] Example 3 Cloning of porcine ITGB1BP2 promoter
[0086] Using the mRNA sequence of the porcine ITGB1BP2 gene (accession number: DQ002920) as a seed, it was compared in the porcine genome, and the following primers for porcine ITGB1BP2 promoter amplification were designed according to its 5' flanking sequence:
[0087] Forward primer ITGB1BP2pF: 5'GTAGGGGATTCCTCCAAT3';
[0088] Reverse primer ITGB1BP2pR: 5'CCACAGCCTTTGTTATGG3'.
[0089] Using large white pig genomic DNA as a template, carry out PCR amplification, the results are shown in figure 2 shown.
[0090] See Table 5 and Table 6 for the PCR reaction system and PCR reaction conditions.
[0091] Table 5 PCR reaction system
[0092]
[0093] Use BioTeKe's Gel Purification Kit (Spin-column) kit (operate according to the instructions of the kit) to recover the PCR amplification product, and clone it into the pMD18-T vector (Promega Beijing Biotechnology Co., Ltd., the U.S. Promega Company in China), extracted ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 