SM gene for regulating and controlling cotton trichome, and application thereof

A gene and cotton technology, which is applied to the regulation of the SM gene of cotton wool and its application field, can solve the problems of rare application of cotton molecular markers and few applications.

Inactive Publication Date: 2013-01-16
ZHEJIANG FORESTRY UNIVERSITY
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Compared with RFLP, RAPD, SSR and AFLP markers, SSCP is easy to operate, sensitive and does not require special instruments, and the combination of PCR technology and SSCP technology further improves the simplicity and sensitivity of mutation detection methods. It has been widely used in animal and zoological research, but relatively less in plant research, and even less in cotton molecular markers. Therefore, the use of SSCP technology is very important for the construction of cotton genetic maps, gene positioning, gene cloning and molecular markers. Significant aspects such as marker-assisted selection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SM gene for regulating and controlling cotton trichome, and application thereof
  • SM gene for regulating and controlling cotton trichome, and application thereof
  • SM gene for regulating and controlling cotton trichome, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: SM gene precise positioning

[0020] 1) Creation of fine-mapping groups

[0021] Use group A diploid African cotton No. 1 (A1, with fiber and hair, see figure 1 A) and group A diploid mutant Asian cotton No. 3 (A2, light seed, light rod, see figure 1 A) create F 2 Large population: 2366 strains [A2-113(s ma-4 )×A1-97 ( T 1 )] F 2 Mapping groups.

[0022] 2) Cotton genomic DNA extraction

[0023] a) Take 0.2 g of fresh cotton leaves, put them into a mortar, add liquid nitrogen to grind to powder, quickly transfer to a 2.0 ml centrifuge tube, add 600 μl of preheated (65°C) CTAB extract (0.1 M Tris-HCl, pH8.0; 0.02M EDTA, pH8.0; 2% CTAB, 2% PVP40; 1 M sodium chloride; 0.2% β-mercaptoethanol), 65°C water bath for 60min, every 10min Shake once.

[0024] b) After the water bath, cool down to room temperature and add about 700ul of chloroform:isoamyl alcohol:absolute ethanol (volume ratio 76:4:20), mix well up and down, after static layering, centrifuge a...

Embodiment 2

[0037] Example 2: Obtaining the full-length sequence of the SM gene

[0038] 1) Obtain the full-length sequence of the gene using comparative genomics

[0039] According to the results of precise positioning and sequence comparison, it was determined that sma-4 / T1 Located in the third linkage group (LG.A3), and through the method of chromosome walking sma-4 / T1 limit Set within the interval of 340,000 bp. Determine the target gene by gene annotation, and design two sets of cross primers (5'-tcttctgaggtctgtctctg-3' / 5'-aaggcagcagctaagctatt-3' and 5'-attgcagcaacagcaagctc-3' and 5'- acttcaaacccctttctctc -3') to obtain two nucleic acid sequences covering the full length. After splicing and integrating the two sequences, the complete SM gene full-length genome sequence was obtained.

[0040] The full-length genome sequence of the group A diploid African cotton SM gene is shown in SEQ ID NO:4.

[0041] 2) Acquisition of full-length cDNA sequence

[0042] a) Extracti...

Embodiment 3

[0080] Embodiment 3: SM gene promoter sequence acquisition

[0081] Through the analysis of the reported cotton D genome Scaffold sequence, primers were designed to obtain the SM gene promoter sequence as shown in SEQ ID NO:3. Method is with embodiment 2.

[0082] Upstream primer: 5'-AATACCCTTTCATTGTCGATAAT-3'

[0083] Downstream primer: 5'-TTAACAAAGTGCTCGAATGTC-3'.

[0084] And it is shown through experiments that SM gene can control the production of fluff and affect fiber quality, and can be used to improve cotton fiber quality.

[0085]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an SM gene for regulating and controlling cotton trichome, belonging to the technical field of genetic engineering. The cDNA sequence of the SM gene is shown by SEQ ID No: 1. The invention provides theoretical basis for the regulation and control of the cotton trichome and provides another way for improving the quality of cotton fiber; and the molecular marker obtained by the SM gene can be applied to multiple aspects such as building a genetic map, locating the gene or quantitative trait locus (QTL), breeding assisted by marking, analyzing genetic diversity, researching genome and the like.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an SM gene for regulating cotton fluff and its application. Background technique [0002] Cotton is one of the important economic crops in China and even in the world, and its fiber is an important raw material for light industry manufacturing. For a long time, people have been very interested in the generation, development mechanism and quality improvement of cotton fiber, but so far the molecular mechanism of cotton fiber initiation and development is still poorly understood. The production and development of cotton hairs are similar to cotton fibers, both of which are extended from a single epidermal cell. It is of great significance to clarify the growth and development process of cotton hairs to reveal the molecular mechanism of cotton fiber growth and development. [0003] Trichome is a unique structure in the epidermal tissue of the aboveground par...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C12N15/113C07K14/415A01H5/00
Inventor戎均康何沙俄丁明全曹跃芬
OwnerZHEJIANG FORESTRY UNIVERSITY