Method for detecting enterovirus neutralizing antibody and special recombinant virus for method

A technology of enterovirus and recombinant virus, which is applied in the direction of virus/bacteriophage, chemical instruments and methods, botany equipment and methods, etc., can solve the problems of high cost, cumbersome operation, and danger, and achieve simple cost, easy standardization, The effect of easy operation

Inactive Publication Date: 2013-02-06
NAT INST OF BIOLOGICAL SCI BEIJING
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The antibody titer determined by the HI method has good reproducibility, and the VN method is superior to the HI method in sensitivity; another disadvantage of the HI method is that fresh blood cells must be used for each observation of agglutination.
In addition, not all virus neutralizing antibodies can inhibit hemagglutination, so this method is more suitable for use with virus neutralization tests, and is not suitable for large-scale neutralizing antibody screening tests
[0007] At present, the methods for detecting neutralizing antibodies, such as the neutralization test of live viruses, mostly use completely infectious viruses. Although the results of such methods are reliable, the disadvantage is that the live viruses are prone to antigenic drift during the passage process, and more importantly, in the There are dangers during the test operation, so there are high requirements for the operation and safety equipment of technicians
Other detection methods that do not require the use of live viruses also have various defects.
For example, the correlation with the results of the standard virus neutralization test is not good (ELISA method), the operation is cumbersome (antigen-antibody indirect agglutination inhibition test), and the cost is expensive (rapid fluorescent focus inhibition test), so it is not suitable for large-scale rapid screening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting enterovirus neutralizing antibody and special recombinant virus for method
  • Method for detecting enterovirus neutralizing antibody and special recombinant virus for method
  • Method for detecting enterovirus neutralizing antibody and special recombinant virus for method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Embodiment 1, detect the neutralizing antibody of enterovirus EV71

[0067] 1. The effectiveness of qualitative detection of neutralizing antibodies against enterovirus EV71 and the titer of quantitative detection of neutralizing antibodies against enterovirus EV71

[0068] 1. Construction of EV71FY structural protein expression plasmid and EV71FY replicon plasmid

[0069] (1) Preparation of EV71 FY cDNA

[0070] Get the live virus EV71 / Fuyang.Anhui.P.R.C of EV71 FY (the public can obtain from Beijing Institute of Life Sciences, and the non-patent literature that has recorded this material is: Zhang, Y., Zhu, Z., Yang, W., Ren , J., Tan, X., Wang, Y., Mao, N., Xu, S., Zhu, S., Cui, A., Zhang, Y., Yan, D., Li, Q., Dong , X., Zhang, J., Zhao, Y., Wan, J., Feng, Z., Sun, J., Wang, S., Li, D. and Xu, W. An emerging recombinant human enterovirus 71 responsible for the 2008 outbreak of hand foot and mouth disease in Fuyang city of China. Virol. J. 7, 94 (2010)) culture flu...

Embodiment 2

[0120] Embodiment 2, detect the neutralizing antibody of Coxsackie virus A16

[0121] 1. Qualitative detection of the effectiveness of neutralizing antibodies against Coxsackievirus A16

[0122] 1. Construction of structural protein expression plasmids

[0123] (1) According to the DNA sequence of the structural protein gene of the G10 strain of Coxsackievirus A16 (NCBI sequence number: NC 001612), primers for whole gene synthesis were designed, and the gene was synthesized by PCR reaction. The primer sequences at both ends used in the whole gene synthesis are as follows:

[0124] CA16G10-F1-40: TGGACGAGCTGTACAAGGCCATTACTACCCTTGGGTCACA,

[0125] CA16G10-F2601-2624: AAAATAACAACACTATAAACCGGTAGCAGGTCAGTATGTG

[0126] (2. Construction of Cox A16 structural protein expression plasmid

[0127] The gene sequence of green fluorescent protein (EGFP) was spliced ​​with the gene sequence of all structural proteins of Cox A16, and 2A pro The restriction site of protease is inserted i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting an enterovirus neutralizing antibody and a special recombinant virus for the method and provides a DNA (deoxyribonucleic acid) molecule. The DNA molecule is a recombinant DNA obtained by substituting coding genes of all structural proteins in cDNA (complementary DNA) corresponding to genome RNA (ribonucleic acid) of an enterovirus for report genes. An EV71 FY pseudovirus system is used for the method for detecting the neutralizing antibody, and since pseudoviruses subjected to monocyclic infection are adopted, the safety problem during using of live viruses is avoided. After multiple tests, results show that the pseudovirus system is the method for detecting the neutralizing antibody and is safe, sensitive, rapid, specific, simple, convenient and low in cost. Based on the advantages, the pseudovirus system is extremely suitable for rapid and massive neutralizing antibody detection tests, and has important application values for virus vaccine development and detection of hand-foot-and-mouth disease specificity neutralizing antibody level of individual patients and patient populations.

Description

technical field [0001] The invention relates to a method for detecting enterovirus neutralizing antibody and special recombinant virus thereof. Background technique [0002] Enterovirus 71 (EV71) and Coxsackievirus A16 (coxsackievirus A16, CA16) are members of the genus Enterovirus in the family Picornaviridae, and they are responsible for causing hand, foot, and mouth disease in children. and foot and mouth disease (HFMD) are the two main pathogens. The pathogen of HFMD prevalent in my country in the 1980s and 1990s was mainly CA16, but since 2008, local outbreaks of hand-foot disease have occurred in many areas in mainland China, which is basically caused by the co-circulation of EV71 and CA16 (Qumei, Li Jie, Jia Lei, Tan Xiaojuan, Gao Zhiyong, Yan Hanqiu, Guo Jing, Li Xitai, Li Xinyu, Wang Quanyi, Xu Wenbo, Huang Fang; Pathogen composition of hand, foot and mouth disease in Beijing in 2009 and genetic characteristics of Coxsackie group A virus type 16; Acta Virology; Vol....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/41C12N15/53C12N15/63C12N5/10C12N1/15C12N1/19C12N1/21C12N7/01C07K14/085C12Q1/70C12Q1/66C12Q1/02G01N21/64
Inventor李文辉宋子林陈盼祁永和梁争论吴星沈心亮
OwnerNAT INST OF BIOLOGICAL SCI BEIJING