PCV2 (porcine circovirus 2) ELISA (enzyme-linked immuno sorbent assay) antigen detection kit as well as preparation method and applications thereof
A porcine circovirus and antigen detection technology, which is applied in the fields of botanical equipment and methods, biochemical equipment and methods, applications, etc., can solve the problem that the specificity or sensitivity of the kit cannot meet the market detection and other problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0083] Example 1 Construction of recombinant baculovirus
[0084] The Bac-to-Bac system was used to construct a recombinant baculovirus, and the following primers were designed according to the gene sequence published by GENBANK (NCBI accession number EU340257.1):
[0085] P1: TCTGGATCCATGACGTATCCAAGGAGGCG
[0086] P2: GCGAAGCTTTAAGGGTTAAGTGGGGGGTC
[0087] P3: TCTCTCGAGATGACGTATCCAAGGAGGCG
[0088] P4: GCGGGTACCTAAGGGTTAAGTGGGGGGTC
[0089] Using the PCV2b strain ORF2 sequence as a template (the template was synthesized according to the published PCV2b ORF2 sequence: accession number EU340257.1), P1, P2 amplify the PCV2ORF2 gene, and clone the gene into the pMD-19T vector to obtain a recombinant The vector pMD-19T-ORF2-1 uses the PCV2b strain ORF2 sequence as a template, P3, P4 amplify the PCV2ORF2 gene, and clone the gene into the pMD-19T vector to obtain the recombinant vector pMD-19T-ORF2-2.
[0090] PMD-19T-ORF2-1 was digested with BamH I and Hind III, the ORF2 gene was cloned ...
Embodiment 2
[0091] Example 2 Serum-free suspension culture of insect cells in a bioreactor and quantitative expression of Cap protein
[0092] Culture Sf9 insect cells aseptically in a 1000ml shake flask for 3-4 days, until the concentration grows to 3-5×10 6 cells / ml, when the viability is greater than 95%, inoculate the cells into a 5L bioreactor with a concentration of 3-8×10 5 cells / ml. When the cell concentration reaches 3-5×10 6 When cells / ml, inoculate the cells into a 50L bioreactor and wait until the cells grow to a concentration of 3-5×10 6 cells / ml, inoculate into a 500L bioreactor, until the cell concentration reaches 2-8×10 6 In cells / ml, inoculate recombinant virus rBac-2ORF2 or rBac-ORF2, the multiplicity of infection (MOI) is 0.001-10, the reactor culture condition is pH 6.0-6.5, temperature 25-27℃, dissolved oxygen 30-80%, stirring Speed 100-180rpm. Considering the optimal conditions for cell culture, the preferred pH is 6.2, the cell culture stage temperature is set ...
Embodiment 3
[0098] Example 3 Purification of VLP particles and observation by electron microscope
[0099] Harvest the expression cell culture, centrifuge the cell culture at 10000g at 4°C for 30min, remove the cell debris, take the supernatant, centrifuge the supernatant at 31000rpm for 3h (Beckman SW70 rotor), resuspend the pellet with a small amount of PBS, and wait until the pellet is completely dissolved , Add CsCl according to 2.1g / 4.5ml solution, mix evenly, dispense into 5ml ultracentrifuge tube, add PBS, to the distance 2-3mm from the tube mouth, after accurate balance, 149000g, 10℃ centrifugal 24h. After centrifugation, two light yellow zona pellucida can be seen. The target zone (lower zone) is sucked out and collected, which is the purified virus-like particle, which is the PCV2-Cap protein. See the test results Image 6 .
[0100] Take the same amount of cell cultures expressing rBac-ORF2 and rBac-2ORF2 under the same conditions, and process them as described above, dilute t...
PUM
| Property | Measurement | Unit |
|---|---|---|
| concentration | aaaaa | aaaaa |
| Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 