Unlock instant, AI-driven research and patent intelligence for your innovation.

Antagonistic bacteria for prevention and treatment of tobacco bacterial wilt and application thereof

A technology of tobacco bacterial wilt and antagonistic bacteria, applied in the direction of application, bacteria, fungi, etc., can solve the problems that crop rotation measures cannot be realized, the control effect is not ideal, and the impact is relatively large

Inactive Publication Date: 2014-07-30
SHAOWU BRANCH OF NANPING TOBACCO +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, agricultural measures such as disease-resistant varieties and crop rotations are mainly used in production to prevent and control tobacco soil-borne diseases. However, because disease-resistant varieties require diversification of disease-resistant genes and are greatly affected by the environment, the control effect is not ideal.
Crop rotation is also one of the effective methods to prevent and control tobacco bacterial wilt, but due to the large number of people in our country and the lack of land, normal crop rotation measures in production cannot be realized

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antagonistic bacteria for prevention and treatment of tobacco bacterial wilt and application thereof
  • Antagonistic bacteria for prevention and treatment of tobacco bacterial wilt and application thereof
  • Antagonistic bacteria for prevention and treatment of tobacco bacterial wilt and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Embodiment 1, isolation and screening of tobacco bacterial wilt antagonistic bacteria

[0039] 1) Isolation of pathogenic bacteria

[0040] Before isolating the bacteria, rinse the tobacco rods clean, then use 75% alcohol to disinfect the tobacco rods and the knife, and then use a knife to cut open the lesion on the stem of the tobacco plant under aseptic conditions, and remove the vascular tissue of the susceptible part. Cut into several small pieces, pick up the cigarette pieces with sterilized tweezers and put them into the beef extract peptone bacterial plate culture dish for cultivation, put 5 pieces in each dish, repeat 3 dishes, the cultivation temperature is 32°C, and the cultivation time is 48h. White fluid colonies grow and disperse fine bacteria outwards when the bacterial wilt cigarette block contacts with the medium, and inoculate it in beef extract peptone for preservation.

[0041] The micrographs showed that bacterial wilt pathogen was rod-shaped, blunt...

Embodiment 2

[0056] Embodiment 2, morphological observation

[0057] The initial colony of QJ-1 bacteria is flat, milky white, smooth and opaque.

[0058] The initial stage of Ty-3 bacteria is white hyphae, and then produces dark brown or dark brown spores, which are abundant.

Embodiment 3

[0059] Embodiment 3, identification and classification of antagonistic bacteria

[0060] The results identified by the Institute of Microbiology, Chinese Academy of Sciences are:

[0061] 1. QJ-1 is Bacillus cereus.

[0062] 1) Cell morphology and physical and chemical test results

[0063] Gram-positive, the cells are rod-shaped, the cell diameter is greater than 1 μm, spores are formed, and the spores do not expand; VP test, methyl red test, starch hydrolysis, casein decomposition, gelatin hydrolysis, catalase, oxidase, nitrate reduction reaction , Utilization of citrate were positive; acid production reaction performance: glucose positive, xylose, L-arabinose, mannitol, lactose negative.

[0064] 2) 16S rRNA gene sequence determination results

[0065] GCAGTCGAGC GATGGATTAA GAGCTTGCTCTTATGAAGTTAGCGGCGGAC

[0066] GGGTGAGTAA CACGTGGGTA ACCTGCCCAT AAGACTGGGA TAACTCCGGG

[0067] AAACCGGGGC TAATACCGGA TAACATTTTG AACTGCATGG TTCGAAATTG

[0068] AAAGGCGGCT TCGGCTGCCA CTTATGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses antagonistic bacteria for prevention and treatment of tobacco bacterial wilt and application thereof. The antagonistic bacteria are Bacillus cereus QJ-1 and Aspergillus niger Ty-3. Specifically, the preservation unit of QJ-1 is China Center for Type Culture Collection, the preservation address is Wuhan University, Wuhan, China, the preservation date is July 5, 2012, and the preservation number is: CCTCC, NO:M2012271; and the preservation unit of Ty-3 is China Center for Type Culture Collection, the preservation address is Wuhan University, Wuhan, China, the preservation date is July 8, 2011, and the preservation number is CCTCC NO:M2011241. The antagonistic bacteria, i.e. the Bacillus cereus QJ-1 and Aspergillus niger Ty-3 provided in the invention can be combined into a microbial agent. The microbial agent and an organic material can be fermented into a microbial organic fertilizer, which can provide effective nutrition and functional bacteria, and realize effective prevention and treatment of tobacco bacterial wilt.

Description

technical field [0001] The invention relates to antagonistic bacteria for preventing and treating tobacco bacterial wilt, and also relates to the application of the antagonistic bacteria in preventing and treating tobacco soil-borne diseases, belonging to the field of biological control. Background technique [0002] Tobacco bacterial wilt is an important soil-borne disease of tobacco, which usually infects the roots of tobacco, causes diseases of crop roots and even the whole plant, and causes significant economic losses. Tobacco bacterial wilt is a systemic infectious disease caused by Ralstonia solanacearum. Once the tobacco plant is infected, the whole plant often dies. The damage is often devastating, so it often causes significant economic losses to tobacco production. . The pathogenic bacteria of tobacco bacterial wilt mainly survives the winter in the soil along with plant residues, and can also survive the winter in seeds or other hosts in the field. The soil with ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C12N1/14A01N63/04A01N63/00A01P1/00C05F11/08C12R1/085C12R1/685
Inventor 谢廷鑫李红丽曾强李小龙卢阿虔王岩
Owner SHAOWU BRANCH OF NANPING TOBACCO