Gene for constructing 5-aminolevulinic acid C4 biosynthesis pathway in Escherichia coli and construction method thereof
A biosynthetic technology of aminolevulinic acid, applied in the field of genetic engineering and microbial fermentation, can solve the problems of no enhanced synthesis and enhanced ALA secretion pathway
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0196] Example 1 A gene for constructing 5-aminolevulinic acid C4 biosynthetic pathway in E. coli and its construction method
[0197] 1. A gene for constructing 5-aminolevulinic acid C4 biosynthetic pathway in E. coli
[0198] 5-aminolevulinic acid C4 biosynthetic pathway Escherichia coli engineered bacteria, with the aid of pETDuet-1 vector, co-express three genes: ALA synthetase gene hemA Coenzyme A transferase gene cat And ALA secretory gene YBi The sequence of the engineered bacteria is as follows:
[0199] ggggaattgt gagcggataa caattcccct ctagaaataa ttttgtttaa ctttaagaag
[0200] gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcatg
[0201] gactacaatc tggcactcga taccgctctg aaccggctcc ataccgaggg ccggtaccgg
[0202] accttcatcg acatcgagcg gcgcaagggt gccttcccga aagccatgtg gcgcaagccc
[0203] gacgggagcg agaaggaaat caccgtctgg tgcggcaacg actatctcgg catgggccag
[0204] catccggtgg tgctgggggc catgcacgag gcgctggatt cgaccggcgc cgggtcgggc
[0205] ggcacgcgca acatctcggg caccacgctc...
Embodiment 2
[0383] 1. Cloning of ALA C4 related genes and construction of co-expression vector
[0384] Will be ligated on the cloning plasmid hemA, Cat, YBi Three gene fragments were sequenced, and the lengths were 1224bp, 1524bp, and 987bp, respectively.
[0385] Said hemA The length of the gene is 1224bp, and its base sequence is as follows:
[0386] ATGGACTACAATCTGGCACTCGATACCGCTCTGAACCGGCTCCATACCGAGGGCCGGTACCGGACCTTCATCGACATCGAGCGGCGCAAGGGTGCCTTCCCGAAAGCCATGTGGCGCAAGCCCGACGGGAGCGAGAAGGAAATCACCGTCTGGTGCGGCAACGACTATCTCGGCATGGGCCAGCATCCGGTGGTGCTGGGGGCCATGCACGAGGCGCTGGATTCGACCGGCGCCGGGTCGGGCGGCACGCGCAACATCTCGGGCACCACGCTCTATCACAAGCGCCTCGAGGCCGAGCTCGCCGACCTGCACGGCAAGGAAGCGGCGCTGGTCTTCTCGTCGGCCTATATCGCCAACGACGCGACCCTCTCGACGCTGCCGCAGCTGATCCCGGGCCTCGTCATCGTCTCGGACAAGTTGAACCACGCTTCGATGATCGAGGGCATCCGCCGCTCGGGCACCGAGAAGCACATCTTCAAGCACAATGACCTCGACGACCTGCGCCGGATCCTGACCTCGATCGGCAAGGACCGTCCGATCCTCGTGGCCTTCGAATCCGTCTATTCGATGGATGGCGACTTCGGCCGCATCGAGGAGATCTGCGACATCGCCGACGAGTTCGGCGCGCTGAAATACATCGACGAGGTCCATG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
