Gene for constructing 5-aminolevulinic acid C4 biosynthesis pathway in Escherichia coli and construction method thereof

A biosynthetic technology of aminolevulinic acid, applied in the field of genetic engineering and microbial fermentation, can solve the problems of no enhanced synthesis and enhanced ALA secretion pathway

Inactive Publication Date: 2013-06-12
HEBEI UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the above-mentioned synthetic method of ALA, only for hemA Molecular manipulation of genes, the constructed genetically engineered bacteria are limited to t

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for constructing 5-aminolevulinic acid C4 biosynthesis pathway in Escherichia coli and construction method thereof
  • Gene for constructing 5-aminolevulinic acid C4 biosynthesis pathway in Escherichia coli and construction method thereof
  • Gene for constructing 5-aminolevulinic acid C4 biosynthesis pathway in Escherichia coli and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0196] Example 1 A gene for constructing 5-aminolevulinic acid C4 biosynthetic pathway in E. coli and its construction method

[0197] 1. A gene for constructing 5-aminolevulinic acid C4 biosynthetic pathway in E. coli

[0198] 5-aminolevulinic acid C4 biosynthetic pathway Escherichia coli engineered bacteria, with the aid of pETDuet-1 vector, co-express three genes: ALA synthetase gene hemA Coenzyme A transferase gene cat And ALA secretory gene YBi The sequence of the engineered bacteria is as follows:

[0199] ggggaattgt gagcggataa caattcccct ctagaaataa ttttgtttaa ctttaagaag

[0200] gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc cgaattcatg

[0201] gactacaatc tggcactcga taccgctctg aaccggctcc ataccgaggg ccggtaccgg

[0202] accttcatcg acatcgagcg gcgcaagggt gccttcccga aagccatgtg gcgcaagccc

[0203] gacgggagcg agaaggaaat caccgtctgg tgcggcaacg actatctcgg catgggccag

[0204] catccggtgg tgctgggggc catgcacgag gcgctggatt cgaccggcgc cgggtcgggc

[0205] ggcacgcgca acatctcggg caccacgctc...

Embodiment 2

[0383] 1. Cloning of ALA C4 related genes and construction of co-expression vector

[0384] Will be ligated on the cloning plasmid hemA, Cat, YBi Three gene fragments were sequenced, and the lengths were 1224bp, 1524bp, and 987bp, respectively.

[0385] Said hemA The length of the gene is 1224bp, and its base sequence is as follows:

[0386] ATGGACTACAATCTGGCACTCGATACCGCTCTGAACCGGCTCCATACCGAGGGCCGGTACCGGACCTTCATCGACATCGAGCGGCGCAAGGGTGCCTTCCCGAAAGCCATGTGGCGCAAGCCCGACGGGAGCGAGAAGGAAATCACCGTCTGGTGCGGCAACGACTATCTCGGCATGGGCCAGCATCCGGTGGTGCTGGGGGCCATGCACGAGGCGCTGGATTCGACCGGCGCCGGGTCGGGCGGCACGCGCAACATCTCGGGCACCACGCTCTATCACAAGCGCCTCGAGGCCGAGCTCGCCGACCTGCACGGCAAGGAAGCGGCGCTGGTCTTCTCGTCGGCCTATATCGCCAACGACGCGACCCTCTCGACGCTGCCGCAGCTGATCCCGGGCCTCGTCATCGTCTCGGACAAGTTGAACCACGCTTCGATGATCGAGGGCATCCGCCGCTCGGGCACCGAGAAGCACATCTTCAAGCACAATGACCTCGACGACCTGCGCCGGATCCTGACCTCGATCGGCAAGGACCGTCCGATCCTCGTGGCCTTCGAATCCGTCTATTCGATGGATGGCGACTTCGGCCGCATCGAGGAGATCTGCGACATCGCCGACGAGTTCGGCGCGCTGAAATACATCGACGAGGTCCATG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a gene for constructing a 5-aminolevulinic acid C4 biosynthesis pathway in Escherichia coli and a construction method thereof. By analyzing the problems of rate-limiting steps, intermediate supply, product secretion and the like of the 5-aminolevulinic acid C4 biosynthesis pathway, a Rhodobactersphaeroides-derived ALA synthetase gene hemA, a Propionibacterium shermanil-derived coenzyme A transferase gene (Cat) and an Escherichia coli-derived ALA secretor gene (YBi) are cloned; by the aid of a pETDuet-1 co-expression vector, the gene hemA for synthesizing the 5-aminolevulinic acid, the gene Cat for generating the intermediate succinic acid COA for synthesizing the 5-aminolevulinic acid, and the gene Ybi for promoting secretion of the 5-aminolevulinic acid are co-expressed; and the co-expression of the three genes reinforces the biosynthesis of the 5-aminolevulinic acid. The gene with C4 biological pathway enhances the 5-aminolevulinic acid yield of Escherichia coli, and the ALA secreted out of the cells reaches 1124 mg/L.

Description

technical field [0001] The invention relates to the fields of genetic engineering and microbial fermentation, in particular to a gene for constructing 5-aminolevulinic acid C4 biosynthetic pathway in Escherichia coli and a construction method thereof. Background technique [0002] 5-Aminolevulinic acid (ALA) is a hydrocarbon containing oxygen and nitrogen elements. It is a precursor for the synthesis of tetrahydropyrrole, porphyrin, (ferrous) heme, chlorophyll and vitamin B 12 structural analogs. ALA is a non-protein amino acid with very active physiological activity, and its application range is very wide. In agriculture, it is widely used as a light-activated green and pollution-free herbicide, insecticide, antimicrobial agent and plant growth promoter. In medicine, ALA is applied to the photodynamic therapy and diagnosis of cancer; it also has the effect of promoting hemoglobin production. In addition, 5-aminolevulinic acid can be used as an external medicine for the t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/11C12N15/60C12N15/54C12N15/70C12N1/21
Inventor 冯惠勇刘天佳李天明戴宝新刘静文
Owner HEBEI UNIVERSITY OF SCIENCE AND TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap