Antarctic ice algae CPD photolyase, and coding gene, expression vector and application thereof

A technology of photorepair enzymes and Antarctic ice algae, applied in the field of biology, can solve the problems of research difficulties such as the separation and purification of biological photorepair enzymes and in vitro activity, and the lack of photorepair enzymes. benefit effect

Active Publication Date: 2013-06-19

QINGDAO HENGSHENG BIOLOGICAL PHARMA TECH DEV

2 Cites 13 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0004] The content of photorepair enzymes in organisms is very small, and each cell has about 10 to 20 photorepair enzyme molecules, which make...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Method used

1, transfer to culture dish after the Antarctic ice algae centrifugal concentration of logarithmic growth phase, cultivate under ultraviolet light, irradiation intensity is 60 μ W/cm , cultivate respectively 0,0.5,1,2,4,6h , followed by quantitative fluorescence analysis. Three replicates were set for each sampling point. As shown in Figure 1: the expression of photoremediation enzyme genes in Antarctic ice algae is significantly affected by ultraviolet rays. Under the condition of ultraviolet irradiation, with the prolongation of time, the expression of photorepair enzyme gene first increased and then decreased, and the increase range was very significant. After 6 hours of UV irradiation, the expression of photorepair enzyme gene reached the maximum value, which was 50 times that of normal light.

The erythema reaction is after a certain dose of ultraviolet radiation to the skin, after a period of time, the radia...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Abstract

The invention discloses an Antarctic ice algae CPD photolyase which is a protein (a) or (b): (a) amino acid sequence disclosed as SEQ ID NO:2; or (b) (a)-derived protein with CPD photolyase activity subjected to substitution, deletion or addition of 1-10 amino acid residues on the amino acid sequence in (a). The invention also discloses a coding gene and an expression vector of the Antarctic ice algae CPD photolyase, and application of the Antarctic ice algae CPD photolyase in the related fields of cosmetics and biomedicine. The invention clones the Antarctic ice algae CPD photolyase gene for the first time, successfully clones the Antarctic ice algae CPD photolyase gene into the expression vector to obtain abundant CPD photolyase, applies the CPD photolyase to the related fields of cosmetics, biomedicine and the like, and can actively restore diseases caused by ultraviolet rays, thereby bringing about huge social benefit and having important meanings.

Application Domain

Cosmetic preparationsPeptide/protein ingredients +7

Technology Topic

EnzymeBiomedicine +10

Image

Examples

Experimental program(8)

Example Embodiment

[0041] Example 1. Obtaining the cDNA sequence of Antarctic ice algae Chlamydomonas sp.ICE-L CPD photorepair enzyme

[0042] 1. Cultivation of Antarctic ice algae and isolation of total RNA

[0043] The Antarctic ice algae were cultured to logarithmic phase at 4°C, and RNA was extracted with Trizol from Invitrogen. The experiment was carried out in accordance with the extraction procedure instructions of Trizol reagent. During the whole process, no RNase contamination was ensured. The extracted RNA was divided into small aliquots and stored in a refrigerator at -80°C for later use.

[0044] 2. Obtain the cDNA sequence of CPD light repair enzyme gene

[0045] Design primers based on the ice algae transcriptome sequence obtained in the previous stage:

[0046] 5’-RACE primer GSP1: CGAGCACATGGGTCGTTCCTCTTATCG

[0047] 3’-RACE primer GSP2: TGGGACGGAAGTGGAGGGATGAGGT

[0048] Reverse transcription of the obtained high-quality RNA to synthesize cDNA.

[0049] The 5’-RACE reverse transcription system is as follows:

[0050]

[0051] The 3’-RACE reverse transcription system is as follows:

[0052]

[0053] Slightly shake and centrifuge for a few seconds. Incubate at 42℃ for 90min, 70℃ for 10min, and chill on ice for more than 2min; dilute with Tricine-EDTA buffer, store at -20℃ for later use.

[0054] The PCR reaction system is as follows:

[0055]

[0056] The PCR reaction conditions are: 94°C for 30s, 72°C for 3min, 5 cycles; 94°C for 30s, 70°C for 30s, 72°C 3min, 5 cycles; 94°C for 30s, 68°C for 30s, 72°C 3min, 27 cycles. After PCR, it was recovered with 1.0% agarose, connected to pMD18-T, transformed into E.coliDH5α, and verified by sequencing. Use NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) online tool to apply BLAST program for sequence homology comparison and similarity analysis; use DNAstar software for sequence splicing, and Align in NCBI to confirm that the target gene is the complete coding region sequence of the photorepair enzyme gene.

Example Embodiment

[0057] Example 2. Construction of Antarctic Ice Algae Chlamydomonas sp. ICE-L CPD Photorepair Enzyme Expression Vector

[0058] 1. Design primers based on the complete sequence of the photorepair enzyme gene obtained by sequencing:

[0059] CPDF:TAGAATTCATGCCGAAGCGAAC

[0060] CPDR: TATCTCGAGTCAAGCTCGTGGC

[0061] The PCR reaction conditions were: pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 2 minutes for 30 cycles.

[0062] 2. The PCR amplification product of the photorepair enzyme gene and the prokaryotic expression vector pET-28a(+) were digested with EcoRI and XhoⅠ at 37°C for 2 hours, respectively, and recovered with 1.0% agarose. The purified target fragments And the vector was ligated with T4DNA ligase at 16°C for 16h, the ligation system is as follows.

[0063]

[0064] 3. Transform the ligated recombinant plasmid into E. coli DH5α, the steps are as follows:

[0065] (1) Take 300 μL of competent cells in a 1.5 mL centrifuge tube, and ice bath for 5 minutes.

[0066] (2) Add 5 μL of the ligated plasmid to each tube, gently swirl to mix the contents, and ice bath for 30 minutes.

[0067] (3) Heat shock at 42°C for 90s, do not shake the test tube.

[0068] (4) Take a 10 mL sterile test tube, add 800 μL LB liquid medium to each tube, and ice bath.

[0069] (5) Take 200 μL of transformed cells and add 800 μL of LB liquid medium, and culture with shaking at 150 rpm at 37°C for 45 min.

[0070] (6) Spread 100 μL of the transformed bacterial solution on the surface of the plate, and incubate at 37°C for 12 to 16 hours.

[0071] 4. Pick the white colonies and place them in 5 mL of kanamycin-containing LB liquid medium, culture them with shaking at 37°C for 8-12 hours, and extract plasmids by alkaline lysis for identification by restriction enzyme digestion. The identified correct plasmid was transformed into E. coli BL21(DE3) by the same method, and the recombinant strain BL21(DE3)/pET-28a(+)/phr was obtained by sequencing.

Example Embodiment

[0072] Example 3. Purification and protein detection of Antarctic ice algae Chlamydomonas sp.ICE-L CPD photorepair enzyme

[0073] 1. Inoculate the recombinant strain BL21(DE3)/pET-28a(+)/phr into 5 mL of kanamycin-containing LB liquid medium, and cultivate overnight at 37°C with shaking. The next day, 5 mL of bacterial solution was added to 500 mL of the same medium and cultured for 2 to 3 hours (OD600 about 0.6). IPTG with a final concentration of 1 mM was added, cultured with shaking at 10°C for 24 hours, and centrifuged at 8000g for 10 minutes to collect the bacteria.

[0074] 2. Ni agarose affinity column affinity chromatography: load the metal chelating agent Ni agarose into the chromatography column and equilibrate with 1×Ni column binding buffer. Put the supernatant on the column. It is generally eluted with 40mM imidazole to obtain the target protein.

[0075] 3. Take the above-mentioned induced expression of BL21(DE3)/pET-28a(+)/phr cell and the protein expressed by the purified phr gene, and mix them with an equal volume of 2× loading buffer, and bath in 100℃ water for 3~5min. . Prepare 12% SDS-PAGE separating gel and 5% concentrated gel, take 30μL and add sample to the gel, put 100V in the concentrated gel, 120V in the separation gel, perform SDS-PAGE constant pressure electrophoresis, use the gel after electrophoresis Stain with polyacrylamide gel staining solution.

[0076] The result is image 3 As shown, where M represents the standard molecular weight, P represents BL21(DE3)/pET-28a(+)/phr bacterial protein, N represents the empty vector strain control, and the arrow is the expressed Antarctic ice algae Chlamydomonas sp.ICE-L CPD light Repair enzymes. It shows that the above method can be used to obtain the Antarctic ice algae Chlamydomonas sp.ICE-L CPD photorepair enzyme.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

PUM

Property	Measurement	Unit
Sub-mass	64.3
tensile		MPa
Particle size		Pa
strength	10

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine

Login to view more

Extraction and purification method of triterpene acid in seabuckthorns, triterpene acid, triterpenoid saponin and application of triterpene acid and triterpenoid saponin

InactiveCN109111496AStay in shapeAnti agingSugar derivativesMetabolism disorderTriterpenoid CompoundChemistry

Owner:QINGHAI TSINGHUA BIOTRY BIO TECH

Classification and recommendation of technical efficacy words

Anti aging
Good social benefits

Antarctic ice algae CPD photolyase, and coding gene, expression vector and application thereof

A technology of photorepair enzymes and Antarctic ice algae, applied in the field of biology, can solve the problems of research difficulties such as the separation and purification of biological photorepair enzymes and in vitro activity, and the lack of photorepair enzymes. benefit effect

AI-Extracted Technical Summary

Problems solved by technology

Method used

Abstract

Image

Examples

Example Embodiment

Example Embodiment

Example Embodiment

PUM

Description & Claims & Application Information

Similar technology patents

Cultivation method of selenium-rich coreopsis tinctoria

Freckle-removing and inflammation-diminishing sunscreen cream and preparation method thereof

Solid beverage for assisting blood glucose regulation

Multifuntional health-care oral liquid

Extraction and purification method of triterpene acid in seabuckthorns, triterpene acid, triterpenoid saponin and application of triterpene acid and triterpenoid saponin

Classification and recommendation of technical efficacy words

Protection film with blue-ray-resistant and full-ultraviolet-preventing adhesive layer

Collagen bioactive peptide, preparation and use thereof

Health care tea paste and preparation method of health care tea paste

Maca Cordyceps buccal tablet and preparation method thereof

Application of bamboo leaf general flavone as antisenility skin care factor in cosmetics

Composite admixture for cement or high-performance concrete and preparation method thereof

Method for treating cobalt-nickel-copper hydrometallurgy wastewater residue

Treatment equipment and process of oily sludge and sand

Heavy caliber pipe-jacking butt joint technique

Voice recognition and voice tag recoding and regulating method of mobile information terminal