Antarctic ice algae CPD photolyase, and coding gene, expression vector and application thereof
A technology of photorepair enzymes and Antarctic ice algae, applied in the field of biology, can solve the problems of research difficulties such as the separation and purification of biological photorepair enzymes and in vitro activity, and the lack of photorepair enzymes. benefit effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0041] Example 1. Obtaining the cDNA sequence of Antarctic ice algae Chlamydomonas sp.ICE-L CPD photorepair enzyme
[0042] 1. Cultivation of Antarctic ice algae and isolation of total RNA
[0043] The Antarctic ice algae were cultured to logarithmic phase at 4°C, and RNA was extracted with Trizol from Invitrogen. The experiment was carried out in accordance with the extraction procedure instructions of Trizol reagent. During the whole process, no RNase contamination was ensured. The extracted RNA was divided into small aliquots and stored in a refrigerator at -80°C for later use.
[0044] 2. Obtain the cDNA sequence of CPD light repair enzyme gene
[0045] Design primers based on the ice algae transcriptome sequence obtained in the previous stage:
[0046] 5’-RACE primer GSP1: CGAGCACATGGGTCGTTCCTCTTATCG
[0047] 3’-RACE primer GSP2: TGGGACGGAAGTGGAGGGATGAGGT
[0048] Reverse transcription of the obtained high-quality RNA to synthesize cDNA.
[0049] The 5’-RACE reverse transcription sys...
Example Embodiment
[0057] Example 2. Construction of Antarctic Ice Algae Chlamydomonas sp. ICE-L CPD Photorepair Enzyme Expression Vector
[0058] 1. Design primers based on the complete sequence of the photorepair enzyme gene obtained by sequencing:
[0059] CPDF:TAGAATTCATGCCGAAGCGAAC
[0060] CPDR: TATCTCGAGTCAAGCTCGTGGC
[0061] The PCR reaction conditions were: pre-denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, annealing at 55°C for 1 minute, and extension at 72°C for 2 minutes for 30 cycles.
[0062] 2. The PCR amplification product of the photorepair enzyme gene and the prokaryotic expression vector pET-28a(+) were digested with EcoRI and XhoⅠ at 37°C for 2 hours, respectively, and recovered with 1.0% agarose. The purified target fragments And the vector was ligated with T4DNA ligase at 16°C for 16h, the ligation system is as follows.
[0063]
[0064] 3. Transform the ligated recombinant plasmid into E. coli DH5α, the steps are as follows:
[0065] (1) Take 300 μL of comp...
Example Embodiment
[0072] Example 3. Purification and protein detection of Antarctic ice algae Chlamydomonas sp.ICE-L CPD photorepair enzyme
[0073] 1. Inoculate the recombinant strain BL21(DE3) / pET-28a(+) / phr into 5 mL of kanamycin-containing LB liquid medium, and cultivate overnight at 37°C with shaking. The next day, 5 mL of bacterial solution was added to 500 mL of the same medium and cultured for 2 to 3 hours (OD600 about 0.6). IPTG with a final concentration of 1 mM was added, cultured with shaking at 10°C for 24 hours, and centrifuged at 8000g for 10 minutes to collect the bacteria.
[0074] 2. Ni agarose affinity column affinity chromatography: load the metal chelating agent Ni agarose into the chromatography column and equilibrate with 1×Ni column binding buffer. Put the supernatant on the column. It is generally eluted with 40mM imidazole to obtain the target protein.
[0075] 3. Take the above-mentioned induced expression of BL21(DE3) / pET-28a(+) / phr cell and the protein expressed by the p...
PUM
Property | Measurement | Unit |
---|---|---|
Sub-mass | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2023 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap