Recombinant expression vector pEGFP (Plasmid Enhanced Green Florescence Protein)-DsRed-BP and application thereof to detection of activity of phiC31 integrase in mammalian cell

A technology of pegfp-dsred-bp and expression vector, which is applied in the fields of bioengineering and protein activity detection, can solve problems such as high detection cost and impact on transfection efficiency, and achieve high signal-to-noise ratio, simple and convenient implementation, and high fluorescence intensity Effect

Active Publication Date: 2013-10-09
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection index of the former is easily affected by the transfection efficiency, and the detection index of the latter requires professional and expensive reagent detection boxes to release the fluorescent signal, and the detection cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant expression vector pEGFP (Plasmid Enhanced Green Florescence Protein)-DsRed-BP and application thereof to detection of activity of phiC31 integrase in mammalian cell
  • Recombinant expression vector pEGFP (Plasmid Enhanced Green Florescence Protein)-DsRed-BP and application thereof to detection of activity of phiC31 integrase in mammalian cell
  • Recombinant expression vector pEGFP (Plasmid Enhanced Green Florescence Protein)-DsRed-BP and application thereof to detection of activity of phiC31 integrase in mammalian cell

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1: Construction of pEGFP-DsRed-BP vector

[0050] According to the minimum attB and attP sequences published in the literature, artificially synthesize the sequence containing the minimum attB and the reverse complementary sequence of attP, attB: CGGTGCGGGTGCCAGGGCGTGCCCTTGGGCTC CCCGGGCGCGTACTCCACC, attP reverse complementary sequence: GTAGTGCCCCAACTGGGG TAACCTTTGAGTTCTCTCAGTTGGGGGCGTAG, add Nhe Ⅰ at the left and right ends of the attB sequence and Age Ⅰ enzyme cutting sites, add BamH Ⅰ and Pst Ⅰ ​​enzyme cutting sites at the left and right ends of the reverse complementary sequence of attP respectively. Using the pDsRed-monomer-N1 vector as a template, design the upstream primer Pred1 (EcoR Ⅰ): GGAATTCCACCGGTCGCCACCAT; the downstream primer Pred2 (Xho Ⅰ): CCGCTCGAGCGTAGAGTCGCGGCCGCTCT. Using the pair of primers synthesized above, carry out PCR amplification with the pDsRed-monomer-N1 vector as a template, and sequence and identify the amplified DsRed-monomer...

Embodiment 2

[0051] Example 2: Co-transfection of CHO, HEK293 and BHK cells with pCMVInt and pEGFP-DsRed-BP

[0052] CHO, HEK293 and BHK cells were seeded in six-well cell culture plates, and when the cell confluence reached 50%, 3 μg of plasmid (1.5 μg pCMVInt and 1.5 μg pEGFP-DsRed-BP) and 6 μl of Transfection reagent, mix and let stand for 30min. Aspirate the culture medium in the 6-well plate completely, wash it twice with serum-free culture medium, and wash away the serum. Add 1.5ml of serum-free culture medium to the mixture of plasmid and liposome, mix gently, carefully drop into a 6-well plate, and store at 37°C in 50ml / L CO 2 Incubate for 6 h in the incubator. Discard the transfection solution, add 2ml (DMEM containing 100ml / L serum) cell culture medium to continue culturing.

Embodiment 3

[0053] Example 3: Detection of fluorescent cells

[0054] After 24 hours of transfection, the above-mentioned cell culture plate was observed under a fluorescent microscope. It was found that DsRed was expressed in CHO, HEK293 and BHK cells, see the attached image 3 , 4 and 5. It indicated that φC31 integrase could play a role in these three kinds of cells. Fluorescent cells were digested, collected by centrifugation, and resuspended in PBS buffer for flow cytometry analysis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of bioengineering and protein activity detecting and discloses a recombinant expression vector pEGFP (Plasmid Enhanced Green Florescence Protein)-DsRed-BP and a preparation method thereof. The expression vector contains a vector skeleton pEGFP-C1, a reverse complement inserted DsRed gene sequence, a phiC31 integrase identification sequence attB and a reverse complement inserted attP sequence. The invention further discloses a method for detecting the activity of phiC31 integrase in a mammalian cell by adopting the expression vector. The method is used for quantitatively or quantitatively detecting the activity of the phiC31 integrase in the mammalian cell according to the type of fluorescence emitted by a co-transfected cell or the proportion among different fluorescent cells. According to the method, the activity of the phiC31 integrase in the mammalian cell can be intuitively evaluated through fluorescent protein just by once transfection, and therefore, the detection method is simple and convenient, reliable in result and low in detection cost.

Description

technical field [0001] The invention relates to the technical field of bioengineering and protein activity detection, in particular to a recombinant expression vector pEGFP-DsRed-BP and its application in detecting the activity of φC31 integrase in mammalian cells. Background technique [0002] The φC31 integrase derived from Streptomyces phage can specifically catalyze the recombination reaction between the phage genome and the host genome. In this recombination reaction, φC31 integrase can recognize and mediate recombination between attB (minimum 34bp) and attP (minimum 39bp) DNA fragments (Groth A C, Olivares E C, Thyagarajan B, et al.A phage integrase directs efficient site -specific integration in human cells.Proc.Natl.Acad.Sci.USA,2000,11:5995-6000), resulting in heterozygous attL and attR after recombination, and these two new heterozygous sites cannot be detected by φC31 integrase Recognized again, so the recombination reaction has the characteristics of one-way. N...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66C12Q1/25C12Q1/02G01N21/64
Inventor景志忠刘太安房永祥
OwnerLANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI