RT-LAMP (reverse transcription-loop-mediated isothermal amplification) detection kit for infectious pancreatic necrosis virus of rainbow trout
A technology for detecting kits and necrotic viruses, applied in the biological field, can solve the problems of low sensitivity, low specificity, and difficulty in on-site application, and achieve high sensitivity and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1 Obtaining of amplification primer set
[0036] A primer set for loop-mediated constant temperature amplification designed according to the relatively conserved VP2 / NS region in the genome sequence of infectious pancreatic necrosis virus. Download the nucleic acid sequences of 9 strains of infectious pancreatic necrosis virus from different regions of the world from the GenBank database. .1. Use the sequence analysis software Clustal X for homology comparison, and use the online PrimerExplorer V4 biological software to design primers for loop-mediated constant temperature amplification in the eight regions with the highest homology, and use the primer analysis function in Primer Premier 5.0 biological software Specific analysis of various parameters of the designed primers was carried out to finally determine the primer set for 6 loop-mediated constant temperature amplification of the present invention, and further use it as the core to prepare a detection ...
Embodiment 2
[0037] Example 2 RT-LAMP detection kit for rainbow trout infectious pancreatic necrosis virus
[0038] The RT-LAMP detection kit for rainbow trout infectious pancreatic necrosis virus was prepared according to the following formula:
[0039] 1. LAMP reaction solution A: containing 10× isothermal reaction buffer, AMV 5U / μL, Rnasin 20U / μL, Bst DNA polymerase 8U / μL, 10mM dNTP, 25mM magnesium sulfate, 20μM internal primer 1, 20μM internal primer 2, 10 μM Outer Primer 1, 10 μM Outer Primer 2, 30 μM Loop Primer 1, 30 μM Loop Primer 2, and 5 M Betaine, where: 10× isothermal reaction buffer containing 200 mM tris-hydrochloride (pH 8.8), 100 mM Cl Potassium chloride, 100mM ammonium sulfate, 20mM magnesium sulfate and 1% Triton X-100;
[0040]Internal primer 1: (SEQ ID NO: 1)
[0041] TCGGGGTCATACTTGCCATAGCTTTTCTGATCCCCAACCCAGAAC
[0042] Inner primer 2: (SEQ ID NO:2)
[0043] ATGATCCTGTCCCACAGGGAGGTTTTCGCTCCTTGTACTCCTCAGT
[0044] Outer primer 1: GCTGGAGTGTCCAACTACG (SEQ ID NO: 3)...
Embodiment 3
[0050] Example 3 Rainbow trout infectious pancreatic necrosis virus RT-LAMP detection kit method for detecting rainbow trout infectious pancreatic necrosis virus
[0051] The above-mentioned rainbow trout infectious pancreatic necrosis virus RT-LAMP detection kit detects rainbow trout infectious pancreatic necrosis virus method, and its steps include:
[0052] 1. Extraction of RNA from samples
[0053] Take kidneys and spleens from diseased fish, add appropriate amount of sterile water, grind with a grinder to a homogenate liquid, freeze-thaw repeatedly at -20°C to room temperature for more than 2 times, centrifuge at 5000rpm / min for 5min, and take the supernatant for later use;
[0054] Virus-infected cell fluid: can be directly used to extract RNA;
[0055] A. Add 400 μl of the sample to be tested in a 1.5ml centrifuge tube, add 600 μl Trizol, shake and mix vigorously, add 400 μl chloroform, mix upside down, act at -20°C for 10 minutes, and centrifuge at 13000 rpm / min for 1...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 