Unlock instant, AI-driven research and patent intelligence for your innovation.

RT-LAMP (reverse transcription-loop-mediated isothermal amplification) detection kit for infectious pancreatic necrosis virus of rainbow trout

A technology for detecting kits and necrotic viruses, applied in the biological field, can solve the problems of low sensitivity, low specificity, and difficulty in on-site application, and achieve high sensitivity and strong specificity

Inactive Publication Date: 2013-11-27
QINGDAO AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] An object of the present invention is to solve the long period required for detecting rainbow trout infectious pancreatic necrosis virus in the prior art, difficulty in field application, low specificity and low sensitivity To solve this problem, provide a detection kit and method for detecting rainbow trout infectious pancreatic necrosis virus based on loop-mediated isothermal amplification (Loop-mediated isothermal amplification, LAMP), which can be widely used in rainbow trout farms and grassroots detection units on-site disease diagnosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RT-LAMP (reverse transcription-loop-mediated isothermal amplification) detection kit for infectious pancreatic necrosis virus of rainbow trout
  • RT-LAMP (reverse transcription-loop-mediated isothermal amplification) detection kit for infectious pancreatic necrosis virus of rainbow trout

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1 Obtaining of amplification primer set

[0036] A primer set for loop-mediated constant temperature amplification designed according to the relatively conserved VP2 / NS region in the genome sequence of infectious pancreatic necrosis virus. Download the nucleic acid sequences of 9 strains of infectious pancreatic necrosis virus from different regions of the world from the GenBank database. .1. Use the sequence analysis software Clustal X for homology comparison, and use the online PrimerExplorer V4 biological software to design primers for loop-mediated constant temperature amplification in the eight regions with the highest homology, and use the primer analysis function in Primer Premier 5.0 biological software Specific analysis of various parameters of the designed primers was carried out to finally determine the primer set for 6 loop-mediated constant temperature amplification of the present invention, and further use it as the core to prepare a detection ...

Embodiment 2

[0037] Example 2 RT-LAMP detection kit for rainbow trout infectious pancreatic necrosis virus

[0038] The RT-LAMP detection kit for rainbow trout infectious pancreatic necrosis virus was prepared according to the following formula:

[0039] 1. LAMP reaction solution A: containing 10× isothermal reaction buffer, AMV 5U / μL, Rnasin 20U / μL, Bst DNA polymerase 8U / μL, 10mM dNTP, 25mM magnesium sulfate, 20μM internal primer 1, 20μM internal primer 2, 10 μM Outer Primer 1, 10 μM Outer Primer 2, 30 μM Loop Primer 1, 30 μM Loop Primer 2, and 5 M Betaine, where: 10× isothermal reaction buffer containing 200 mM tris-hydrochloride (pH 8.8), 100 mM Cl Potassium chloride, 100mM ammonium sulfate, 20mM magnesium sulfate and 1% Triton X-100;

[0040]Internal primer 1: (SEQ ID NO: 1)

[0041] TCGGGGTCATACTTGCCATAGCTTTTCTGATCCCCAACCCAGAAC

[0042] Inner primer 2: (SEQ ID NO:2)

[0043] ATGATCCTGTCCCACAGGGAGGTTTTCGCTCCTTGTACTCCTCAGT

[0044] Outer primer 1: GCTGGAGTGTCCAACTACG (SEQ ID NO: 3)...

Embodiment 3

[0050] Example 3 Rainbow trout infectious pancreatic necrosis virus RT-LAMP detection kit method for detecting rainbow trout infectious pancreatic necrosis virus

[0051] The above-mentioned rainbow trout infectious pancreatic necrosis virus RT-LAMP detection kit detects rainbow trout infectious pancreatic necrosis virus method, and its steps include:

[0052] 1. Extraction of RNA from samples

[0053] Take kidneys and spleens from diseased fish, add appropriate amount of sterile water, grind with a grinder to a homogenate liquid, freeze-thaw repeatedly at -20°C to room temperature for more than 2 times, centrifuge at 5000rpm / min for 5min, and take the supernatant for later use;

[0054] Virus-infected cell fluid: can be directly used to extract RNA;

[0055] A. Add 400 μl of the sample to be tested in a 1.5ml centrifuge tube, add 600 μl Trizol, shake and mix vigorously, add 400 μl chloroform, mix upside down, act at -20°C for 10 minutes, and centrifuge at 13000 rpm / min for 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit for rapidly detecting an infectious pancreatic necrosis virus of rainbow trout by utilizing a loop-mediated isothermal amplification (LAMP) technique and a detection method of the infectious pancreatic necrosis virus of rainbow trout. The kit comprises reaction liquid A and reaction liquid B, wherein the reaction liquid A contains 10*isothermal reaction buffer liquid, 5U / microliter of AMV, 20U / microliter of Rnasin, 8U / microliter of Bst DNA (Deoxyribose Nucleic Acid) polymerase, 10mM of dNTP (deoxy-ribonucleoside triphosphate), 25mM of magnesium sulfate, 20 micrometers of inner primers 1, 20 micrometers of inner primers 2, 10 micrometers of outer primers 1, 10 micrometers of outer primers 2, 30 micrometers of circular primers 2 and 5M of lycine; the reaction liquid B is 1000*fluorochrome SYBR (Synergy Brands) GreenI. According to the kit, the rapid detection of the infectious pancreatic necrosis virus is realized by carrying out methods of the RNA (Ribose Nucleic Acid) extraction in tissue samples or cell culture liquid, the loop-mediated isothermal amplification of the infectious pancreatic necrosis virus, the color development and detection of amplified products and the like. With the adoption of the technique, the defects that the detection time is long, the operation is complicated, expensive instruments are required, and the like in the existing technical detection are overcome, and the technique is suitable for rapid spot detection in livestock farms, veterinary stations and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a kit for rapidly detecting rainbow trout infectious pancreatic necrosis virus by using a loop-mediated isothermal amplification (LAMP) technology and a use method thereof. Background technique [0002] Infectious pancreatic necrosis disease (IPNV) is an acute infectious disease of salmonid fish caused by infectious pancreatic necrosis virus (IPNV), and the mortality rate of juvenile rainbow trout is as high as 90%. In 1984, the disease broke out in a rainbow trout farm in Northwest my country, and the mortality rate of juvenile fish was as high as 99.65%, and then the epidemic situation in China was occasionally reported. At the same time, IPNV often occurs in countries where a large number of salmon and trout are farmed, such as the United States, Japan, Canada and Europe. In view of the fact that the disease occurs in a large area in the countries where salmon and trout are raised ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 侯竹美方华华丰艳妮王凤舞王金叶
Owner QINGDAO AGRI UNIV