Method for obtaining and fermenting prokaryotic genetic-engineered hybrid cationic antimicrobial peptide CC

A hybrid antimicrobial peptide and genetic engineering technology, which is applied in genetic engineering and biological fields, can solve the problems of large-scale production, high molecular weight and low content of antimicrobial peptides, etc.

Inactive Publication Date: 2013-12-25
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF5 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In order to obtain antimicrobial peptides, people mainly use three methods: 1. Extract natural peptides directly from organisms, but the content is very small, and the extraction process is complicated, the cost is high, and it is difficult to meet the requirements of large-scale production; 2. Chemical synthesis
This method is only suitable for very short antimicrobial peptides, but most antimicrobial peptides have relatively large molecular weights and are not suitable for chemical synthesis; 3. Most of the antimicrobial peptides with relatively large molecular weights use genetic engineering methods, which have been thoroughly studied , and is an effective way to produce antimicrobial peptides

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for obtaining and fermenting prokaryotic genetic-engineered hybrid cationic antimicrobial peptide CC
  • Method for obtaining and fermenting prokaryotic genetic-engineered hybrid cationic antimicrobial peptide CC
  • Method for obtaining and fermenting prokaryotic genetic-engineered hybrid cationic antimicrobial peptide CC

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Preparation of antimicrobial peptides

[0083] The nucleotide sequence contained in the hybrid antimicrobial peptide CC:

[0084] CGC GATCCGCCGGGTTGGCTGAAAAAACTGGGCAAGCTGAAG GCCCATAAGGCCACCATCCAAACC ACTGGCGCCGCCCAACAAGCCGCCAACGTTGCCGCCACCCTGAAGGGT CGCA

[0085] The codon of the DPP tripeptide sequence (wavy line part) is added to the front end of the sequence, and the BamH I and Sal I restriction endonuclease sites (in the box) and protective bases (two tails) are respectively added to the two ends. , with a stop codon (TAA) added at the end, the underlined part is the partial mature peptide gene sequence of the housefly cecropin antimicrobial peptide, and the unlined part is the partial mature peptide gene sequence of the frog defensin.

[0086] The encoded amino acid sequence, molecular weight, charge number, isoelectric point, and hydrophobic moment are:

[0087] GWLKKLGKLKAHKATIQT IGAAQQAANVAATLKG, 3487.15, +6.5, 11.49, 1.02.

[0088] The second technic...

Embodiment 2

[0102] Construction of hybrid antimicrobial peptide CC Escherichia coli genetically engineered bacteria

[0103] (1) Construction of cloning vector

[0104] After the gene glue of the hybrid antibacterial peptide was recovered, it was connected with pMD18-T Vector, transformed into the competent cells of Escherichia coli TG-1, and the correctness of the test results was verified.

[0105] ①Gel recovery of PCR products

[0106] For the specific method, refer to the instruction steps of the column type small volume gel recovery kit. After completion, 5 μL of the recovered product was detected by electrophoresis on 2% Agarose gel containing EB. The results are attached image 3 shown.

[0107] ② Preparation of Competent Cells

[0108] For the specific method, refer to the instructions of the TaKaRa Competent Cell Preparation Kit (200 times).

[0109] ③Construction of recombinant vector

[0110] The hybrid antimicrobial peptide gene CC was connected with the cloning vector ...

Embodiment 3

[0125] Construction of expression vectors and genetically engineered bacteria

[0126] ①The cloning vector and expression vector pGEX-6P-1 of the hybrid antimicrobial peptide gene were digested with double enzymes

[0127] A single colony of Escherichia coli pMD18-T / CC / TG-1 and Escherichia coli containing the expression vector pGEX-6p-1 was picked, inoculated into 5mL LB / AMP liquid medium for shaking culture overnight, and the plasmid was extracted. The recombinant cloning vector and the expression vector were digested with NEB restriction enzymes BamH I and Sal I respectively. The enzyme digestion reaction system was: 10×NEB buffer 32 μL, plasmid 16.0 μL, 100×BSA 0.2 μL, BamH I0. 8 μL and Sal I 1.0 μL, total volume 20 μL. Add the above components into the PCR reaction tube, and after the parafilm seals it, flick the wall of the PCR reaction tube with your fingers to mix the solution and centrifuge it instantaneously to make the solution concentrate at the bottom of the tube....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for obtaining escherichia coli genetic-engineered bacteria of recombinant hybrid cationic antimicrobial peptide CC. The principle of the method disclosed by the invention is as follows: bioinformatics technology and molecular biological technology are combined to select natural antimicrobial peptide with therapeutic potential, a molecular design of the antimicrobial peptide is carried out, the antimicrobial peptide is synthesized to a gene sequence after being translated, and the escherichia coli genetic-engineered bacteria of hybrid cationic antimicrobial peptide CC is constructed by such technical programs as cloning vector construction, expression vector construction, and the like. A DPP tripeptide sequence is arranged between a GST tag and the antimicrobial peptide, and the DPP tripeptide sequence is purified after being expressed. IPTG (Isopropyl beta-D-1-Thiogalactopyranoside) induction is replaced by lactose induction to reduce the cost and optimize the culture conditions and the culture medium composition, and the lactose induction is combined with fermentation. As shown in a biological activity identification result, the escherichia coli genetic-engineered bacteria has a broad application prospect in food, feed and aquaculture due to efficient antimicrobial activity, thermal stability and pH stability and very weak hemolytic activity.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biotechnology, in particular to a method for obtaining and fermenting prokaryotic genetic engineering hybrid cationic antibacterial peptide CC. Background technique [0002] Antimicrobial peptides are part of the innate immune mechanism of animals, plants and humans, and are induced when the body is attacked by viruses, bacteria, etc. Antimicrobial peptides have a broad-spectrum antibacterial effect, especially for killing some pathogenic bacteria that produce antibiotic resistance, which has aroused people's interest in it. Antimicrobial peptides have great application potential in agriculture, medical treatment, food and other fields. So far, thousands of natural antimicrobial peptides have been discovered, but there are relatively few species with good medical selection index. Obtain ideal new artificial antimicrobial peptides from natural antimicrobial peptide resources. [0003] The...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/435C12N15/12C12N15/70C12N1/21
Inventor张爱忠姜宁蔡鹏王志强孙艳发赵平森任文张晨雪王法明朱双刘晓明
OwnerHEILONGJIANG BAYI AGRICULTURAL UNIVERSITY