Huperzia serrata endophytic fungus and application in preparation of pyrrole type liver-protecting medicines
A technology of Huperzia serrata and endophytic fungi is applied in the field of microorganisms, which can solve the problems that the output cannot be guaranteed for industrialized scale production, many preparation steps, long plant growth cycle, etc., and achieves alleviation of clinical drug shortage, simple fermentation conditions, and fewer process steps. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 Separation of endophytic fungus (Peyronellaea glomerata) HS-ZJUT-XW12
[0030] (1) Collection of samples
[0031] The samples were Huperzia serrata plants collected from Yunnan Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences in September 2007.
[0032] (2) Isolation of strains
[0033] Wash the epidermis and roots of the plant with tap water, immerse the cleaned plant sample in a container containing 75% ethanol, take it out after 2 minutes, rinse it with sterile water for 3-5 times, and then immerse it in a container containing 0.1% mercuric chloride In the container of aqueous solution, keep it for a certain period of time for 1 minute, take it out, and rinse with a large amount of sterile water to remove residual mercury chloride solution. Under sterile operating conditions, use sterilized forceps and blades to peel off the outer skin of the stems of Huperus serrata stems, then cut into 0.3cm×0.3cm tissue pieces and plant them on PDA ...
Embodiment 2
[0036] Example 2 Molecular biological identification of Huperzia serrata endophyte (Peyronellaea glomerata) HS-ZJUT-XW12
[0037] (1) Extraction of DNA
[0038] Take the fermented liquid cultured for 6 days, collect the mycelia by centrifugation, freeze and grind the mycelium with liquid nitrogen, and extract the genomic DNA with the SK1375 genomic DNA extraction kit (manufacturer: Sangon Bioengineering (Shanghai) Co., Ltd.) Sugar gel electrophoresis.
[0039] (2) PCR amplification of ITS region sequence
[0040] The primer sequences are: ITS1: 5'TCCGTAGGTGAACCTGCGG3'; ITS4: 5'TCCTCCGCTTATTGATATGC3'.
[0041] The PCR system (50μL) is composed of: Template (genome) 10pmo1, Primer1 (10μM) 1μL, Primer2 (10μM) 1μL, dNTP mix (10Mm each) 1μL, 10×Taq reaction buffer 5μL, Taq (5U / μL) 0.25μL, add water to 50 μL.
[0042] The PCR program was set as follows: pre-denaturation at 98°C for 5 min, denaturation at 95°C for 35 s, annealing at 55°C for 35 s, extension at 72°C for 40 s, 35 c...
Embodiment 3
[0047] Example 3 Preparation of FPBA by fermentation of the endophytic fungus Peyronellaea glomerata HS-ZJUT-XW12
[0048] (1) Strain activation
[0049] Potato glucose agar medium: 200g of peeled potatoes, 20g of glucose, 15g of agar, 1000mL of water, make a test tube slope, pick mycelium and inoculate it on the test tube slope, culture at 28°C for 7 days;
[0050] (2) Strain fermentation
[0051] Potato glucose liquid medium: 200g peeled potatoes (cut into about 2cm 2 small pieces), put into a beaker and boil for 30min, then filter with double-layer gauze, take the filtrate and add 20g of glucose, add water to make up to 1000mL.
[0052] The endophytic fungus (Peyronellaea glomerata) HS-ZJUT-XW12 strain suspension prepared in step (1) (spore concentration is 1 × 10 6 Each / mL) 1mL was inoculated in a 250mL Erlenmeyer flask (125mL potato dextrose liquid medium was sterilized at 121°C in the bottle), shaken at 28°C and 180 rpm for 6 days, and then cultured statically for 14 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
