Unlock instant, AI-driven research and patent intelligence for your innovation.

Esterase, gene, vector and engineering bacterium derived from thermomyces lanuginosus as well as application

A technology of Thermomyces sp. and genetically engineered bacteria, applied in the field of esterase, can solve the problem of high production cost

Active Publication Date: 2014-04-02
ZHEJIANG UNIV OF TECH
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The chemical-enzymatic production process of pregabalin successfully developed by Pfizer of the United States introduces lipase selective hydrolysis to prepare (3S)-2-carboxyethyl-3-cyano-5-methylhexanoic acid, but the biocatalyst used is Novozymes commercialized lipase lead to high production costs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Esterase, gene, vector and engineering bacterium derived from thermomyces lanuginosus as well as application
  • Esterase, gene, vector and engineering bacterium derived from thermomyces lanuginosus as well as application
  • Esterase, gene, vector and engineering bacterium derived from thermomyces lanuginosus as well as application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Acquisition of T.lanuginosus DSM10635 esterase gene

[0052] Collect the mycelia of T.lanuginosus DSM10635 (from the German Collection of Microorganisms and Cell Cultures (DSMZ)) cultured at 50°C for 3 days, add liquid nitrogen to fully grind to powder, extract total RNA by TRIzol method, and use Promega’s GoScript TM The reverse transcription kit is used to prepare the first strand of cDNA, and the reaction system and conditions refer to the instructions of the kit. Then use primer 1 (GGSTTYASYKCNGGNGG) and oligodT designed according to a conserved sequence of fungal esterase as primers, and use cDNA as a template to carry out PCR amplification under the action of LA-Taq DNA polymerase. The amount of each component in the PCR reaction system (total volume 50 μL): 10×LA-Taq DNA Polymerase Buffer 5 μL, 10 mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5 mM) 0.5 μL, primer 1 and primer oligodT at a concentration of 50 μM 0.5 μL each, 1 μL cDNA, 0.5 μL LA-Ta...

Embodiment 2

[0053] Example 2: Construction of recombinant expression vector pET28-TLE

[0054] According to the analysis result of embodiment 1, design expression primer 4 (GGAATTC CATATG GGCTTGTTTTCAATCCTG), Primer 5 (CCG CTCGAG TTATCCACTGTGGCCAAACTC). Initiated by primer 4 and primer 5, use high-fidelity Pfu DNA polymerase (TaKaRa) to amplify, the amount of each component of the PCR reaction system (total volume 100 μL): 10×Pfu DNA Polymerase Buffer 10 μL, 10 mM dNTP mixture (dATP , dCTP, dGTP and dTTP each 2.5 mM) 0.5 μL, 0.5 μL each of primer 4 and primer 5 at a concentration of 50 μM, 1 μL of cDNA, 1 μL of Pfu DNA Polymerase, and 86.5 μL of nucleic acid-free water. The PCR instrument of Biorad was used, and the PCR reaction conditions were: pre-denaturation at 94°C for 3 minutes, then entering into a temperature cycle of 94°C for 30s, 60°C for 30s, and 72°C for 10 minutes, a total of 30 cycles, and finally extending at 72°C for 10 minutes, and the termination temperature was 8°C....

Embodiment 3

[0056] Embodiment 3: Construction of engineering bacteria E.coli BL21(DE3) / pET28-TLE

[0057] The recombinant expression vector pET28-TLE constructed in Example 2 was transformed into Escherichia coli BL21(DE3), spread on an LB plate containing 50 μg / ml Kan and cultured at 37°C overnight, randomly picked clones for colony PCR identification, positive clones Sequencing verification showed that the recombinant expression vector pET28-TLE was successfully transformed into the expression host E.coli BL21(DE3), and the esterase gene was successfully cloned into the NdeI and XhoI sites of pET-28b.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an esterase, a gene, a vector and an engineering bacterium derived from thermomyces lanuginosus as well as application in preparing (3S)-2-carboxyethyl-3-cyan-5-methyl hexanoic acid. An amino acid sequence of the esterase is represented in SEQ ID NO: 2. The esterase gene disclosed by the invention can be linked to an expression vector to construct an intracellular expression recombinant plasmid containing the gene and the intracellular expression recombinant plasmid is transformed to an escherichia coli strain, thus obtaining recombinant escherichia coli. The recombinant escherichia coli contains the esterase; the recombinant escherichia coli or purified esterase is applied to biological catalysis as a catalyst to produce a pregabalin key chiral intermediate.

Description

(1) Technical field [0001] The invention relates to an esterase obtained from Thermomyces lanuginosus (Thermomyces lanuginosus) DSM10635, a coding gene, a carrier, an engineering bacterium and application. (2) Background technology [0002] Esterase (EC3.1.1.1) is a class of enzymes that can catalyze the hydrolysis and synthesis of esters, and is widely distributed in plants, animals and microorganisms (FEMS Microbiol. Rev. 2002, 26: 73-81). Because the enzymatic reaction catalyzed by esterase has good substrate specificity, regioselectivity or enantioselectivity, esterase is widely used in chiral resolution, which is the synthesis of chiral acid, chiral ester or chiral Important biocatalysts for chiral compounds such as alcohols. [0003] Pregabalin (PGB for short), chemical name (S)-(+)-3-aminomethyl-5-methylhexanoic acid (I), is a structural analog of γ-aminobutyric acid ( Angew. Chem. Int. Ed. 2008, 47:3500-3504). As a calcium ion channel modulator, pregabalin can eff...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/18C12N15/55C12N15/70C12N1/21C12P13/00C12R1/19
CPCY02P20/582C12N9/18C12P13/002C12Y301/01001
Inventor 郑裕国郑仁朝黎小军沈寅初
Owner ZHEJIANG UNIV OF TECH