Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection primer sets, detection kits and detection methods that cause dumps-associated SNPs

A detection kit and detection primer technology, applied in the field of bioengineering, can solve the problems of loss of catalytic function, inability to synthesize pyrimidine nucleotides, disappearance and the like, and achieve the effect of simple method

Inactive Publication Date: 2016-01-13
INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The transcription product of the mutant gene is finally translated into a short protein with 76 amino acid catalytic subunits missing at the C-terminus, resulting in the loss of the catalytic function of converting orotic acid into guanylic acid, and the inability to synthesize pyrimidine nucleotides required for DNA and RNA. As a result, the embryo dies at 40-60 days of pregnancy, and the mortality rate is as high as 100%. At the same time, this mutation can lead to the disappearance of the AvaI restriction site on the DNA sequence.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primer sets, detection kits and detection methods that cause dumps-associated SNPs
  • Detection primer sets, detection kits and detection methods that cause dumps-associated SNPs
  • Detection primer sets, detection kits and detection methods that cause dumps-associated SNPs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] 1. Detection primers and probes that cause DUMPS-related SNPs:

[0043] The detection primers:

[0044] DUMPSF: ttctgaatttgtgattggttttat; (as shown in SEQ ID NO.1)

[0045] DUMPSR: cctcctgcttctaactgaactc; (as shown in SEQ ID NO.2)

[0046] The probes:

[0047] Probe for DUMPS mutation, DUMPSM: ctggctcTgagtaagca (shown in SEQ ID NO.3)

[0048] Probe against DUMPS wild, DUMPSW: ctggctcCgagtaagca (shown in SEQ ID NO.4).

[0049] 2. Preparation and synthesis of standard products: cloning into plasmids and samples

[0050]The wild-type and homozygous mutant templates were synthesized according to the SNP sites of DUMPS published in the DUMPS gene (Genebank: 281568), pGH was used as the cloning vector, and SmaI was used as the restriction site. Primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd., probes were synthesized by Shanghai Jikang Biotechnology Co., Ltd., and the synthetic delivery materials were plasmids and glycerol bacteria. Then the two wild-...

Embodiment 2

[0077] Embodiment 2: sensitivity analysis:

[0078] Use the above-mentioned standard sample (wild type, mutant or heterozygous) plasmid DNA to measure the OD of the purified plasmid DNA sample with a micro-nucleic acid spectrophotometer 260 Absorbance values ​​were converted to nucleic acid concentration values. According to the formula: plasmid copy number / μl={total content (μg / μl)} / {number of plasmid molecular bases×10 -15 μg}, the concentration of purified plasmid DNA was converted into the corresponding gene copy number per unit volume. Then each kind of plasmid DNA is carried out 10 times of serial dilution respectively, gets each dilution degree sample, detects the reaction method of the PCR reaction method that detects DUMPS according to the probe method among the embodiment 1, and each dilution degree all does more than 2 times to repeat In the test, the gene copy number and the amount of DNA template corresponding to the detection end point are calculated according ...

Embodiment 3

[0080] Embodiment 3: repeatability experiment analysis

[0081] In this embodiment, the DNA samples of 24 bovine blood samples were tested, and repeated experiments were performed, as shown in Table 1 and Table 2, and the two results were completely consistent. It shows that our system and reaction conditions are stable.

[0082] Table 1 The results of clinical sample detection by equipment model SLAN96PDUMPS probe method

[0083]

[0084]

[0085]

[0086] Table 2 Repeated results of clinical sample detection by equipment model SLAN96PDUMPS probe method

[0087]

[0088]

[0089]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection primer set, detection kit and detection method of related SNP (single-nucleotide polymorphism) for causing DUMPS (Deficiency of Uridine Monophophate Synthase). The detection primer set of related SNP for causing DUMPS comprises detection primers and probes, wherein the detection primers comprise DUMPS F: ttctgaatttgtgattggttttat and DUMPS R: cctcctgcttctaactgaactc; and the probes comprise a probe for DUMPS mutation DUMPS M: ctggctcTgagtaagca and a probe for DUMPS wild type W: ctggctcCgagtaagca. The invention establishes a method for detecting bovine DUMPS detrimental gene carriers by fluorescence quantitative PCR (polymerase chain reaction). The method is simple, quick and accurate. The method disclosed by the invention can be utilized to further develop the detection kit. The invention provides a new method and idea for typing and screening the milk cow DUMPS detrimental gene, guards the entrance for quarantine inspection of milk cows of China, and provides reliable theoretical references for molecule breeding of milk cows.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a detection primer set, a detection kit and a detection method for causing DUMPS-related SNPs. Background technique: [0002] DUMPS, its full name is Deficiencyofuridinemonophosphatesynthase, that is, "tauuridylate synthase deficiency". It is a relatively common autosomal single-gene mutation recessive genetic disease in Holstein dairy herds, which can lead to early death of negative homozygous offspring embryos. It is a point mutation in the codon 405 at the C-terminus of the heterozygote, and the codon CGA originally encoding arginine is changed to a stop codon TGA. The transcription product of the mutant gene is finally translated into a short protein with 76 amino acid catalytic subunits missing at the C-terminus, resulting in the loss of the catalytic function of converting orotic acid into guanylic acid, and the inability to synthesize pyrimidine nucleot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/6883C12Q2600/156C12Q2561/101
Inventor 吴晓薇洪洁心汪天杰朱道中刘中勇朱事康刘志玲
Owner INSPECTION & QUARANTINE TECH CENT OF GUANGDONG ENTRY EXIT INSPECTION & QUARANTINE BUREAU