Detection primer sets, detection kits and detection methods that cause dumps-associated SNPs
A detection kit and detection primer technology, applied in the field of bioengineering, can solve the problems of loss of catalytic function, inability to synthesize pyrimidine nucleotides, disappearance and the like, and achieve the effect of simple method
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] 1. Detection primers and probes that cause DUMPS-related SNPs:
[0043] The detection primers:
[0044] DUMPSF: ttctgaatttgtgattggttttat; (as shown in SEQ ID NO.1)
[0045] DUMPSR: cctcctgcttctaactgaactc; (as shown in SEQ ID NO.2)
[0046] The probes:
[0047] Probe for DUMPS mutation, DUMPSM: ctggctcTgagtaagca (shown in SEQ ID NO.3)
[0048] Probe against DUMPS wild, DUMPSW: ctggctcCgagtaagca (shown in SEQ ID NO.4).
[0049] 2. Preparation and synthesis of standard products: cloning into plasmids and samples
[0050]The wild-type and homozygous mutant templates were synthesized according to the SNP sites of DUMPS published in the DUMPS gene (Genebank: 281568), pGH was used as the cloning vector, and SmaI was used as the restriction site. Primers were synthesized by Shanghai Jierui Biotechnology Co., Ltd., probes were synthesized by Shanghai Jikang Biotechnology Co., Ltd., and the synthetic delivery materials were plasmids and glycerol bacteria. Then the two wild-...
Embodiment 2
[0077] Embodiment 2: sensitivity analysis:
[0078] Use the above-mentioned standard sample (wild type, mutant or heterozygous) plasmid DNA to measure the OD of the purified plasmid DNA sample with a micro-nucleic acid spectrophotometer 260 Absorbance values were converted to nucleic acid concentration values. According to the formula: plasmid copy number / μl={total content (μg / μl)} / {number of plasmid molecular bases×10 -15 μg}, the concentration of purified plasmid DNA was converted into the corresponding gene copy number per unit volume. Then each kind of plasmid DNA is carried out 10 times of serial dilution respectively, gets each dilution degree sample, detects the reaction method of the PCR reaction method that detects DUMPS according to the probe method among the embodiment 1, and each dilution degree all does more than 2 times to repeat In the test, the gene copy number and the amount of DNA template corresponding to the detection end point are calculated according ...
Embodiment 3
[0080] Embodiment 3: repeatability experiment analysis
[0081] In this embodiment, the DNA samples of 24 bovine blood samples were tested, and repeated experiments were performed, as shown in Table 1 and Table 2, and the two results were completely consistent. It shows that our system and reaction conditions are stable.
[0082] Table 1 The results of clinical sample detection by equipment model SLAN96PDUMPS probe method
[0083]
[0084]
[0085]
[0086] Table 2 Repeated results of clinical sample detection by equipment model SLAN96PDUMPS probe method
[0087]
[0088]
[0089]
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 