Method for detecting dose of ionizing radiation on human peripheral blood lymphocytes
A technology of lymphocytes and ionizing radiation, which is applied in the field of radiation biological dose estimation, can solve the problems of complex technology, which cannot meet the requirements of high-throughput detection, rapid quantitative detection of biological radiation dose, etc., and achieve good repeatability and stability, and save time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Embodiment 1: TaqMan-MGB probe and primer pair design
[0020] 1) Design upstream and downstream primers and probe sequences according to the expression sequence of the lymphocyte pig3 gene.
[0021] The inventors used gene chip technology to screen the differential expression of 45,200 genes in the three dose groups of 0.5, 3 and 8Gy. Among them, the dose change trend of the positively regulated gene of lymphocyte pig3 is obvious, and it is of great significance to explore the expression change of pig3 gene in peripheral blood. The important practical value is closer to the application.
[0022] Lymphocyte pig3 gene expression sequence SEQ ID NO: 1 is:
[0023] ATTTCTCTGAAGCAACGCTGAAATTCACCAAAGGTGCTGGAGTTAATCTTATTCTAGACTGCATAGGCGGATCCTACTGG.
[0024] The upstream primer SEQ ID NO: 2 is: 5'-TCTCTGAAGCAACGCTGAAATTC-3'.
[0025] The downstream primer SEQ ID NO: 3 is: 5'-GTAGGATCCGCCTATGCAGTCTA-3'.
[0026] The probe nucleotide sequence of SEQ ID NO: 4 is: AAAGGTGCTGGA...
Embodiment 2
[0027] Embodiment 2: Construction of standard substance recombinant pUC57 plasmid
[0028] 1), routine method separates single lymphocyte from human peripheral blood;
[0029] 2), conventional methods extract the RNA of a single lymphocyte, and reverse transcribe it into cDNA;
[0030] 3), specific primer PCR amplifies the lymphocyte pig3 gene;
[0031] 4), after the PCR product is purified, according to figure 1 Schematic diagram of the construction of the standard material recombinant pUC57 plasmid, the PCR product was connected to the pUC57 plasmid (provided by Shanghai Sangong Co., Ltd.), and the recombinant pUC57 plasmid was constructed. figure 2 It is the agar gel electrophoresis picture of the recombinant pUC57 plasmid of the standard substance.
[0032] 5) The recombinant pUC57 plasmid was sequenced and verified, and the result was that the lymphocyte pig3 gene expression sequence SEQ ID NO: 1 was correctly inserted into the pUC57 plasmid.
Embodiment 3
[0033] Embodiment 3: the preparation of standard curve
[0034] 1) 10-fold serial dilution of the standard substance recombinant pUC57 plasmid. Utilize the NanoDrop 2000 ultraviolet spectrophotometer to measure the concentration of the recombinant pUC57 plasmid of the standard substance, and dilute the standard substance with double distilled water to 10 8 copies / μl. Add 9 μl of double-distilled water to five 0.5ml centrifuge tubes, draw 1 μl of 10 8 Copy / μl standard substance, add 9μl double-distilled water and mix thoroughly, and then carry out gradient dilution successively, and dilute the standard substance to 10 7 、10 6 、10 5 、10 4 and 10 3 Copies / μl, ready for use when sampling on 96-well plates.
[0035] 2) Fluorescent quantitative PCR was carried out using the 10-fold diluted standard substance recombinant pUC57 plasmid as a template.
[0036] The real-time fluorescence quantitative PCR instrument is the 7500fast Real Time PCR measuring instrument of ABI Compan...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 