Unlock instant, AI-driven research and patent intelligence for your innovation.

Esterolytic enzyme, coding gene, carrier, engineering bacterium and application of coding gene

An ester hydrolase and gene technology, applied in the field of ester hydrolase and its encoding gene, can solve the problems of complexity, difficulty in adoption, high cost and the like, and achieve the effects of high catalytic activity and stereoselectivity

Active Publication Date: 2014-05-28
ZHEJIANG UNIV OF TECH
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

To solve this problem, the occurrence of side reactions can be reduced by means of engineering regulation, and a single enzyme preparation can be obtained by separation and purification to catalyze the reaction. However, these processes are often complicated and costly, and are not easy to be used in reproduction.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Esterolytic enzyme, coding gene, carrier, engineering bacterium and application of coding gene
  • Esterolytic enzyme, coding gene, carrier, engineering bacterium and application of coding gene
  • Esterolytic enzyme, coding gene, carrier, engineering bacterium and application of coding gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1: Cloning of the BMEST gene from Bacillus megaterium

[0029] The degenerate primer 1 and primer 2 were designed according to the DNA sequence of Bacillus megaterium DSM319 lipase (GenBank: CP001982.1).

[0030] Primer 1 sequence: ATGAATATCACAACGTTTGACG

[0031] Primer 2 sequence: TTATTTTTCTGTTGATATGCTTTTC

[0032] The genomic DNA of Bacillus megaterium (Bacillus megaterium) DSM319 was used as a template for PCR amplification (using TakaRa kit). The PCR reaction system and reaction conditions are shown in Table 1 and Table 2. Repeat steps 2 to 4 25 times.

[0033] Table 1: PCR amplification reaction system

[0034]

[0035] Table 2: PCR amplification reaction conditions

[0036]

[0037] The PCR amplification product was detected by 0.8% agarose gel electrophoresis, and the product was a single band with a size of about 1400bp (such as figure 1shown). Purify and recover the PCR product. For specific steps, refer to the instructions of the Beijing Bi...

Embodiment 2

[0038] Embodiment 2: Construction of expression vector and transformant

[0039] A-T ligation of the target fragment with the pEASY-E1 expression vector, the ligation system is as follows in Table 3:

[0040] table 3: p EASY-E1Ex p Ression Vector connection system

[0041]

[0042] The connection system was reacted at 25°C for 15 minutes, and the connection product was added at 50 μ LClone in freshly thawed Trans-T1 competent cells, refer to pEASY-E1Expression Kit instructions for specific operations. PCR method to identify positive recombinants in the correct expression direction (such as figure 2 shown), transferred to LB medium to amplify the vector. The recombinant plasmid pEASY-E1-BMEST was extracted from Trans1-T1 cells with TaKaRa plasmid extraction kit, transformed into E.coli BL21(DE3) competent cells, and positive clones were obtained by screening with Amp-resistant medium and identified by PCR cloning. Contains the correct recombinant plasmid (such as im...

Embodiment 3

[0043] Example 3: Expression of Esterhydrolase

[0044] The genetically engineered strain E.coli BL21(DE3) / pEASY-E1-BMEST was inoculated in 50 mL of LB medium containing 80 μg / mL ampicillin, and cultured overnight at 37° C. with shaking. Take 500 μL of the culture solution and connect it to 50 mL of fresh LB medium containing 80 μg / mL ampicillin. When the OD600 is about 0.5-0.6, add IPTG until the concentration is 0.1 mmol / L to induce, and continue to culture at 25°C and 200 rpm for 10- After 12 hours, the target protein was overexpressed, and the cells were collected by centrifugation.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides esterolytic enzyme from bacillus megaterium, a coding gene of the esterolytic enzyme, a carrier containing the coding gene, an engineering bacterium and application of the coding gene. The amino acid sequence of the esterolytic enzyme is shown as SEQ ID NO. 2; the nucleotide sequence of the encoding gene is shown as SEQ ID NO.1. The recombined esterolytic enzyme provided by the invention can be used for synthesizing a stereoselective catalytic chiral compound and has high catalytic activity and stereoselectivity.

Description

(1) Technical field [0001] The invention relates to an ester hydrolase with S-isomer stereoselectivity and its coding gene, a carrier containing the coding gene, engineering bacteria and application thereof. (2) Background technology [0002] Ester hydrolases include lipase and esterase, which are a class of biocatalysts with important uses in chiral synthesis. These enzymes can recognize a wide range of substrates. At present, more than 40% of biological object synthesis reactions can be catalyzed by ester hydrolases. These reactions have the characteristics of mild conditions, high regioselectivity and high stereoselectivity. It has been widely used in enzymatic kinetic resolution of racemic esters, amines and conversion of pre-chiral alcohols. In addition, they can be used in selective esterification, transesterification and polymerization reactions. [0003] Due to the increasing demand for chiral drugs and intermediates, the use of biological or enzymatic synthesis of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/18C12N15/55C12N15/70C12N1/21C12P41/00C12P7/62
CPCC12N9/20C12P7/62C12P41/001C12Y301/01003
Inventor 郑建永汪钊应向贤章银军
Owner ZHEJIANG UNIV OF TECH