Primers, probes and methods for detecting malaria parasites
A Plasmodium and probe technology, applied in the direction of microorganism-based methods, biochemical equipment and methods, microorganisms, etc., can solve the problems of time-consuming and labor-intensive blood smear inspection methods, complex detection condition settings, low specificity and sensitivity, etc. , to achieve the effect of fast detection speed, stable results and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1: Design and synthesis of primers and probe sequences
[0029] Search for the sequence of SSUrRNA, the target gene of Plasmodium pathogens, from Genebank, use relevant bioinformatics software for homology analysis and BLAST sequence analysis, and screen out highly conserved regions, and use the primer design software PrimerPremier5 to design primers and probes for the conserved sequences ; After the design of primers and probes, use NCBIBLAST to test the specificity, and use Primerpremier5 to detect whether there is a hairpin structure or dimer formation. The results show that the designed probe meets the specificity requirements and will not form a hairpin structure or dimer formation. Polymer. The designed primers and probe sequences are listed in Table 1.
[0030] Table 1 is used to detect the primers and probes of Plasmodium
[0031] name sequence SEQ ID No: PU-F2 TTGTTGCAGTTAAAACGCTCG 1 PU-R2 GCTTTGAACACTCTAATTTACTC 2 ...
Embodiment 2
[0032] Example 2 .Preparation of four Plasmodium-specific probe microsphere sets
[0033] 1. Probe synthesis
[0034] Various probe sequences were synthesized according to SEQ ID No: 3-6 in Table 1, and the 5' ends of all probes were modified with amination and connected with a C12 adjacent arm sequence.
[0035] 2. Coupling of probes and microspheres
[0036] Randomly select 4 different fluorescent microspheres, the numbers of the selected fluorescent microspheres in this embodiment are 45, 49, 52, 56, provided by BioRad, and the nucleic acid probes are coupled according to the following method:
[0037] 1. Put 4 types of microspheres numbered 45, 49, 56, and 52 stored at 2-10°C and 2 bottles of unopened EDC powder (10mg / bottle) stored at -20°C at room temperature for 30-60 minutes;
[0038] 2. The PV-PF2, PM-PF2, PO-PF2, PF-PF2 nucleic acid probes were respectively separated by ddH 2 O dissolved, the concentration is 0.1nmol / μl;
[0039] 3. Vortex the microspheres a...
Embodiment 3
[0062] Example 3 : Detection of Plasmodium in 4 clinical samples
[0063] 1. Sample preparation
[0064] The genomic DNA of No. 1-4 clinical samples was extracted by conventional methods, and the concentration was measured for future use. The clinical samples could be serum or mosquitoes. In this embodiment, human serum was selected as the test sample.
[0065] 2. Multiplex PCR amplification
[0066] 1. Synthetic PCR amplification primers according to SEQIDNo: 1-2 in table 1, wherein the 5' ends of the downstream primers all have biotin modification
[0067] 2. PCR amplification reaction:
[0068] (1) PCR reaction system: PCR amplification reaction system is 20 μl, including 10×PCRBuffer 2 μl, dNTP (2.5 mmol / L) 2 μl, goldTaq enzyme (5U / μl) 0.07 μl, PU-F2 (5 μM) 0.3 μl, PU -R2 (5μM) 1.5μl, genomic DNA 1μl, add ddH 2 O11.6 μl to a final volume of 20 μl; at the same time, set a negative control group, with 1 μlddH 2 O is the template instead of genomic DNA;
[0069] (2)...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More